1. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA sequence

" in MedChemExpress (MCE) Product Catalog:

87

Inhibitors & Agonists

6

Screening Libraries

5

Fluorescent Dyes

5

Biochemical Assay Reagents

22

Peptides

5

Natural
Products

3

Antibodies

2

Click Chemistry

21

Oligonucleotides

1

GMP Molecules

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-15435
    CHAPS
    4 Publications Verification

    Exosomes Biochemical Assay Reagents Others
    CHAPS is a cholic acid-derived, sulfobetaine-type zwitterionic detergent and micelle-forming agent. CHAPS exhibits properties of weak cationic or nonionic surfactants in different solution systems, undergoes micellization, and forms small, loose hydrophilic aggregates that are temperature-dependent. CHAPS stabilizes mononucleosomes under different ionic strengths, reduces nucleosome sequence specificity, promotes sliding of histone cores along DNA, solubilizes Tamm-Horsfall protein to reduce its interference with urinary exosome isolation, and maintains vesicle structure and the activity of related proteins at the same time. CHAPS is used to recover native folded fusion proteins, enhance the binding capacity of GST fusion proteins, and restore GST enzyme activity. However, CHAPS cannot refold proteins denatured by urea, guanidine hydrochloride or heat, nor can it construct the structure of intrinsically disordered proteins. CHAPS is commonly used in research on the separation and purification of membrane proteins .
    CHAPS
  • HY-13642
    RG108
    Maximum Cited Publications
    12 Publications Verification

    N-Phthalyl-L-tryptophan

    DNA Methyltransferase Inflammation/Immunology Cancer
    RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC50=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .
    RG108
  • HY-150751
    ODN TTAGGG
    3 Publications Verification

    ODN A151

    Toll-like Receptor (TLR) AIM2 Pyroptosis Interleukin Related Inflammation/Immunology
    ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
    ODN TTAGGG
  • HY-W040129
    Chromomycin A3
    1 Publications Verification

    DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase Infection Neurological Disease Cancer
    Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg 2+. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .
    Chromomycin A3
  • HY-N2187
    Deoxyshikonin
    3 Publications Verification

    Bacterial HIF/HIF Prolyl-Hydroxylase PI3K Apoptosis Infection Cardiovascular Disease Cancer
    Deoxyshikonin increases the expression of VEGF-C and VEGF-A mRNA in HMVEC-dLy, promotes HIF-1α and HIF-1β subunit interaction and binds to specific DNA sequences targeted by HIF. Deoxyshikonin inhibited colorectal cancer (CRC) through the PI3K/Akt/mTOR pathway. Deoxyshikonin has proangiogenesis effect and antitumor activity. Deoxyshikonin is an antibacterial agent against methicillin-resistant S. aureus (MRSA) and S. pneumonia (MIC=17 μg/mL) .
    Deoxyshikonin
  • HY-107769
    Duocarmycin TM
    1 Publications Verification

    CBI-TMI

    ADC Payload DNA Alkylator/Crosslinker Antibiotic Cancer
    Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.
    Duocarmycin TM
  • HY-12456

    Antibiotic ADC Payload DNA Alkylator/Crosslinker Necroptosis Apoptosis Cancer
    Duocarmycin SA is an orally active antitumor antibiotic with an IC50 of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .
    Duocarmycin SA
  • HY-101160

    DRG16

    DNA Alkylator/Crosslinker ADC Payload Cancer
    SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
    SG2057
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-W406070

    LNA-G

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analog, where LNA (locked nucleic acid) is a nucleic acid analog. LNA modification can be widely used in various fields, such as effective binding affinity with complementary sequences and stronger nuclease resistance than natural nucleotides, providing great potential for application in disease diagnosis and research. 2'-O,4'-C-Methyleneguanosine is a substrate for KOD DNA polymerase, which incorporates LNA-G nucleotides into growing DNA strands, including consecutive incorporations , to generate full-length extension products .
    2'-O,4'-C-Methyleneguanosine
  • HY-W008806

    OHHL; N-(3-Oxohexanoyl)homoserine lactone

    Bacterial Infection Inflammation/Immunology
    N-(3-Oxohexanoyl)-L-homoserine lactone (OHHL; N-(3-Oxohexanoyl)homoserine lactone) is a specific agonist of LuxR-type transcription factor CarR with a Kd of 1.8 μM. N-(3-Oxohexanoyl)-L-homoserine lactone activates CarR by inducing protein multimerization, promoting its binding to target DNA sequences in the carR-carA intergenic region, thereby upregulating the transcription of carbapenem biosynthesis genes. N-(3-Oxohexanoyl)-L-homoserine lactone acts as a quorum sensing signal molecule, enabling bacteria to coordinate the production of carbapenem antibiotics in a cell density-dependent manner. N-(3-Oxohexanoyl)-L-homoserine lactone is used to study bacterial quorum sensing mechanisms, especially the secondary metabolism and virulence factor regulatory pathways of Erwinia carotovora and Yersinia enterocolitica .
    N-(3-Oxohexanoyl)-L-homoserine lactone
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-D1725

    Fluorescent Dye DNA Stain Others
    Cy3-dCTP is a directly fluorescently labeled deoxyribonucleotide, in which Cy3 is a cyanine fluorescent dye. Cy3-dCTP is used for direct enzymatic labeling of DNA and cDNA: with the aid of DNA polymerases, this modified nucleotide is incorporated into the extending DNA strand during processes such as reverse transcription, PCR, nick translation or random primer labeling .
    Cy3-dCTP
  • HY-15435A
    CHAPS hydrate
    4 Publications Verification

    Biochemical Assay Reagents Exosomes Others
    CHAPS hydrate is a cholic acid-derived, sulfobetaine-type zwitterionic detergent and micelle-forming agent. CHAPS hydrate exhibits properties of weak cationic or nonionic surfactants in different solution systems, undergoes micellization, and forms small, loose hydrophilic aggregates that are temperature-dependent. CHAPS hydrate stabilizes mononucleosomes under different ionic strengths, reduces nucleosome sequence specificity, promotes sliding of histone cores along DNA, solubilizes Tamm‑Horsfall protein to reduce its interference with urinary exosome isolation, and maintains vesicle structure and the activity of related proteins at the same time. CHAPS hydrate is used to recover native folded fusion proteins, enhance the binding capacity of GST fusion proteins, and restore GST enzyme activity. However, CHAPS hydrate cannot refold proteins denatured by urea, guanidine hydrochloride or heat, nor can it construct the structure of intrinsically disordered proteins. CHAPS hydrate is commonly used in research on the separation and purification of membrane proteins .
    CHAPS hydrate
  • HY-D1668

    DNA Stain Reverse Transcriptase Infection Neurological Disease Cancer
    Biotin-11-dCTP is a biotinylated deoxynucleoside triphosphate and an important DNA labeling reagent. In random primer DNA labeling reactions, Biotin-11-dCTP incorporates into newly synthesized DNA strands to generate labeled DNA probes suitable for hybridization applications. In addition, Biotin-11-dCTP can serve as a substrate for terminal deoxynucleotidyl transferase to end-label oligonucleotides for telomere sequence detection, or to label the cut ends of linearized DNA molecules, thereby supporting streptavidin-based electron microscopy analysis. For example, Biotin-11-dCTP can label the cut ends of linearized DNA molecules under the action of dGTP and avian myeloblastosis virus reverse transcriptase .
    Biotin-11-dCTP
  • HY-148424

    ADC Payload DNA Alkylator/Crosslinker Cancer
    PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .
    PBD dimer-2
  • HY-132142

    DNA/RNA Synthesis Others
    5-Propargylamino-dCTP is a sustrate for DNA polymerases. 5-Propargylamino-dCTP can conjugate to molecular markers for use in nucleic acid labeling or sequence analysis. 5-Propargylamino-dCTP is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups .
    5-Propargylamino-dCTP
  • HY-P1103
    CTCE-9908
    1 Publications Verification

    CXCR Cancer
    CTCE-9908 is a potent and selective CXCR4 antagonist. CTCE-9908 induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .
    CTCE-9908
  • HY-150751C
    ODN TTAGGG sodium
    3 Publications Verification

    ODN A151 sodium

    AIM2 Toll-like Receptor (TLR) Inflammation/Immunology
    ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
    ODN TTAGGG sodium
  • HY-P4076

    HIV DNA Alkylator/Crosslinker Infection
    MPG peptides, Pβ is an amphipathic cell-penetrating peptide. MPG peptides, Pβ consists of three components: the hydrophobic fusion sequence (GALFLGFLGAAGSTMGA) of HIV glycoprotein 41, a spacer domain (WSQP), and the nuclear localization signal (KKKRKV) of the large T antigen of Simian virus 40. MPG peptides, Pβ can form stable non-covalent complexes with nucleic acids (including DNA) through electrostatic interactions and improve their intracellular delivery. MPG peptides, Pβ can be used in studies of HIV-1-related immune responses .
    MPG peptides, Pβ
  • HY-112951
    ChX710
    4 Publications Verification

    STING Cancer
    ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.
    ChX710
  • HY-137697D

    HIV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Drug Metabolite HIV Protease Infection
    ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP trisodium solution (100 mM)
  • HY-136248
    Cyanine 3 Tyramide
    1 Publications Verification

    Tyramide-Cy3

    DNA Stain Fluorescent Dye Others
    Cyanine 3 Tyramide (Tyramide-Cy3) is an orange fluorescent dye used as a reporter fluorescent substrate for horseradish peroxidase (HRP)-catalyzed deposition, which serves as a signal amplification technique in immunoassays and in situ nucleic acid hybridization .
    Cyanine 3 Tyramide
  • HY-100758
    FUBP1-IN-1
    2 Publications Verification

    DNA/RNA Synthesis Cancer
    FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
    FUBP1-IN-1
  • HY-E70090

    DNA/RNA Synthesis Infection
    T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
    T7 RNA polymerase
  • HY-106262B
    Delcasertib hydrochloride
    3 Publications Verification

    KAI-9803 hydrochloride; BMS-875944 hydrochloride

    PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) hydrochloride is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) hydrochloride could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib hydrochloride
  • HY-122578

    MDM-2/p53 Cancer
    P53R3 is a potent p53 reactivator and restores sequence-specific DNA binding of p53 hot spot mutants, including p53 R175H, p53 R248W and p53 R273H. P53R3 induces p53-dependent antiproliferative effects with much higher specificity than PRIMA-1. P53R3 enhances the recruitment of wild-type p53 and p53 M237I to several target gene promoters. P53R3 strongly enhances the mRNA, total protein and cell surface expression of the death receptor death receptor 5 (DR5). P53R3 is used for cancer research .
    P53R3
  • HY-156228

    Ras Cancer
    RGB-1 selectively binds to and stabilizes RNA G-quadruplex structures, and reduces the expression of the NRAS proto-oncogene in breast cancer cells. RGB-1 can serve as a tool for investigating the cellular functions of RNA G-quadruplex structures and identifying novel mRNA G-quadruplex-forming sequences. RGB-1 is applicable for breast cancer research .
    RGB-1
  • HY-157549A

    AYX1 sodium

    Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide sodium
  • HY-P1310
    VKGILS-NH2
    1 Publications Verification

    Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .
    VKGILS-NH2
  • HY-W591768

    Fluorescent Dye Others
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium (iodide) (Py-NMe2) is a styryl-based dye for fluorescence and CD-based sensing of various ds-DNA/RNA sequence. ( maxλAbs = 450 nm, maxλEm = 615 nm) .
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium iodide
  • HY-107767

    DC 81

    Antibiotic Apoptosis DNA/RNA Synthesis Cancer
    Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .
    Antibiotic DC 81
  • HY-106262

    KAI-9803; BMS-875944

    PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib
  • HY-W001952

    Fluorescent Dye Drug Intermediate Others
    6-Bromo-2-naphthol is an RTP (real-time polymerase chain reaction) probe that forms a 1:1 or 2:1 complex with β-cyclodextrin (β-CD). 6-Bromo-2-naphthol is capable of real-time monitoring of PCR reactions and quantification of specific nucleic acid sequences. RTP probes are a class of small DNA or RNA sequences labeled with fluorescent dyes and quencher molecules, which can be widely used in gene expression analysis, SNP genotyping, and pathogen detection. 6-Bromo-2-naphthol embeds into the cyclodextrin cavity through hydrophobic interactions, inhibits the oxygen quenching effect, and emits a phosphorescent signal at room temperature. 6-Bromo-2-naphthol can also be used as an intermediate for the synthesis of antibacterial azo dyes, and its derivatives show antibacterial activity against Staphylococcus aureus, Escherichia coli and other bacteria .
    6-Bromo-2-naphthol
  • HY-137697

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis HIV Protease HIV Drug Metabolite Infection
    ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP
  • HY-P3215

    Oxytocin Receptor Endocrinology
    Oxytocin parallel dimer is the disulfide-bridged homo peptide dimer. Oxytocin dimer has oxytocin and vasopressin-like activity with less toxic than oxytocin .
    Oxytocin parallel dimer
  • HY-148947

    Fluorescent Dye Phosphoramidites Others
    Cy5 Phosphoramidite is a fluorescent labeling reagent . Cy5 Phosphoramidite serves as a fluorescent tag for 3' terminal labeling of single-stranded DNA, enabling fluorescence-based nucleic acid detection, monitoring, quantification, and in vitro study .
    Cy5 Phosphoramidite
  • HY-160728

    3′-O-Azidomethyl dATP

    Biochemical Assay Reagents Others
    3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP
  • HY-160226

    STING Inflammation/Immunology
    ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.
    ISD Control sodium
  • HY-P1286

    PKC Neurological Disease
    PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate
  • HY-D1180

    3,3′-Diethylthiatricarbocyanine iodide

    Fluorescent Dye Others
    DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of DNA helicity and sequence .
    DTTCI
  • HY-157549

    AYX1

    Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide can reduce acute post-surgical pain. Brivoligide mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide
  • HY-135900

    ADC Payload Bacterial Cancer
    Aniline-MPB-amino-C3-PBD is a cytotoxic agent comprised non-alkylating group. Aniline-MPB-amino-C3-PBD is a sequence-selective DNA minor-groove binding agent. Aniline-MPB-amino-C3-PBD acts as the payload for ADCs. Antimicrobial activity .
    Aniline-MPB-amino-C3-PBD
  • HY-E70212

    Hhal

    DNA Methyltransferase Cancer
    Hhal Methyltransferase (Hhal) is a DNA methyltransferase (recognition sequence: GCGC) .
    Hhal Methyltransferase
  • HY-155869

    5-Fluoro-2′-deoxycytidine 5′-triphosphate

    DNA/RNA Synthesis Others
    5-fluoro-dCTP is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP
  • HY-150729A

    Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1982 sodium is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, and can be used to prepare DNA vaccines. ODN 1982 sodium inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
    ODN 1982 sodium
  • HY-160728A

    3′-O-Azidomethyl dATP trisodium

    Biochemical Assay Reagents Others
    3′-O-N3-dATP trisodium (3′-O-Azidomethyl dATP trisodium) is the trisodium salt form of 3′-O-N3-dATP. 3′-O-N3-dATP trisodium is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP trisodium acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP trisodium solution (100 mM)
  • HY-132243

    Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    NFAT Inhibitor-3 (Compound 10) is a factor nuclear factor of activated T cells (NFAT) inhibitor. NFAT Inhibitor-3 inhibits IL-2 production. NFAT Inhibitor-3 binds in a sequence-selective manner directly to DNA. NFAT Inhibitor-3 can be used for the research of transcription factor dysregulation .
    NFAT Inhibitor-3
  • HY-P1103A

    CXCR Cancer
    CTCE-9908 TFA is a potent and selective CXCR4 antagonist. CTCE-9908 TFA induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .
    CTCE-9908 TFA
  • HY-137697B

    HIV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Drug Metabolite HIV Protease Infection
    ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP trilithium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: