Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
130 Results for "
DNA sequence
" in MedChemExpress (MCE) Product Catalog:
Products (130)
130 Results for "DNA sequence" in MCE Product Catalog:
14
14 Publications Verification
Synonyms: N-Phthalyl-L-tryptophan
Target:
Research Areas:
RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC50=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .
12
12 Cited Publications
Synonyms: Phen-DC3 Triflate
Target:
Research Areas:
Phen-DC3 Trifluoromethanesulfonate is a bisquinolinium G-quadruplex (G4) ligand. Phen-DC3 Trifluoromethanesulfonate selectively binds to and stabilizes the hybrid quadruplex-duplex hybrid (QDH) derived from the PIM1 promoter. Phen-DC3 Trifluoromethanesulfonate also binds to the c-myc promoter Pu24T G4 via extensive π-stacking, and induces polymerase stalling at α-synuclein DNA and RNA G4 sequences. Phen-DC3 Trifluoromethanesulfonate downregulates LPS (HY-D1056)-induced TNFRSF21, RIPK3 and p-MLKL in VECs, and ameliorates CLP-induced pulmonary vascular leakage in septic rats. Phen-DC3 Trifluoromethanesulfonate can be used in studies related to neurodegenerative diseases and sepsis-associated vascular injury .
5
Research Areas:
ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
5
Target:
Research Areas:
ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
4
4 Cited Publications
Cat. No.: HY-N2187
CAS No.: 43043-74-9
4
4 Cited Publications
ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.
4
4 Cited Publications
Target:
Research Areas:
CHAPS is a cholic acid-derived, sulfobetaine-type zwitterionic detergent and micelle-forming agent. CHAPS exhibits properties of weak cationic or nonionic surfactants in different solution systems, undergoes micellization, and forms small, loose hydrophilic aggregates that are temperature-dependent. CHAPS stabilizes mononucleosomes under different ionic strengths, reduces nucleosome sequence specificity, promotes sliding of histone cores along DNA, solubilizes Tamm-Horsfall protein to reduce its interference with urinary exosome isolation, and maintains vesicle structure and the activity of related proteins at the same time. CHAPS is used to recover native folded fusion proteins, enhance the binding capacity of GST fusion proteins, and restore GST enzyme activity. However, CHAPS cannot refold proteins denatured by urea, guanidine hydrochloride or heat, nor can it construct the structure of intrinsically disordered proteins. CHAPS is commonly used in research on the separation and purification of membrane proteins .
4
4 Cited Publications
3
3 Cited Publications
Target:
Research Areas:
FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
3
3 Cited Publications
Cat. No.: HY-106262B
Purity: 99.73%
Synonyms: KAI-9803 hydrochloride; BMS-875944 hydrochloride
Target:
Research Areas:
1
1 Cited Publications
Cat. No.: HY-W040129
CAS No.: 7059-24-7
Category:
1
Research Areas:
Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.
1
1 Cited Publications
Cat. No.: HY-D1668
1
1
1 Cited Publications
Cat. No.: HY-P1310
CAS No.: 942413-05-0
Research Areas:
1
1
1 Cited Publications
Cat. No.: HY-P72503
Purity: ≥ 95%, as determined by reducing SDS-PAGE.
Synonyms: KLRK1; CD314; Prev. D12S2489E; Killer Cell Lectin-Like Receptor Subfamily K, Member 1; NKG2D; NKG2-D-Activating NK Receptor; NKG2-D Type II Integral Membrane Protein; DNA Segment On Chromosome 12 (Unique) 2489 Expressed sequence; NK Cell Receptor D; Kille
Research Areas:
Duocarmycin SA is an orally active antitumor antibiotic with an IC50 of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .
Synonyms: DRG16
Research Areas:
SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
