Search Result

Results for "

antisense+oligonucleotide

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Acyltransferase (2) ADC Linker (1) Akt (2) ANGPTL (2) Apolipoprotein (11) Apoptosis (6) Arp2/3 Complex (1) Bcl-2 Family (3) Biochemical Assay Reagents (1) C-type Lectin-like Receptors (CTLRs) (2) Complement System (2) Connexin (2) DNA/RNA Synthesis (18) Drug Intermediate (4) Dystrophin (12) E1/E2/E3 Enzyme (6) EGFR (2) ERK (1) FAP (2) Fluorescent Dye (6) GCGR (2) GHR (2) Glucocorticoid Receptor (2) HBV (2) HCV (3) HIF/HIF Prolyl-Hydroxylase (2) HIV (4) HSP (2) HSV (2) Huntingtin (5) IFNAR (3) IGF-1R (2) Insulin Receptor (2) Integrin (3) Isotope-Labeled Compounds (2) Kallikrein (2) Liposome (10) MicroRNA (2) Nucleoside Antimetabolite/Analog (6) PCSK9 (5) PD-1/PD-L1 (2) Phosphoramidites (6) PKA (2) PKC (1) PNPLA3 (2) Prion Protein (2) Ras (6) Reactive Oxygen Species (ROS) (1) Ser/Thr Kinase (1) Small Interfering RNA (siRNA) (2) SOD (3) Sodium Channel (3) STAT (3) Survivin (2) Tau Protein (3) TGF-beta/Smad (9) TMPRSS6 (2) TNF Receptor (2) Transthyretin (TTR) (4) α-synuclein (2)
By Research Areas:	Cancer (45) Cardiovascular Disease (14) Endocrinology (4) Infection (14) Inflammation/Immunology (12) Metabolic Disease (25) Neurological Disease (48)
Oligonucleotides:	Pegylated Lipids (1) Guanosine (1) Nucleoside Analogs (2) Uridine (1) CpG ODNs (1) Adenine (3) Phospholipids (2) Cytosine (2) Cationic Lipids (1) Phosphoramidites (6) Antisense Oligonucleotides (173) Guanine (1)

175

Inhibitors & Agonists

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

Isotope-Labeled Compounds

186

Oligonucleotides

GMP Molecules

DOTAP chloride Maximum Cited Publications 14 Publications Verification 1,2-Dioleoyl-3-trimethylammonium-propane chloride	Liposome	Cancer
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .

Mipomersen sodium 2 Publications Verification ISIS 301012	Apolipoprotein HCV	Metabolic Disease
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has *anti-HCV* effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

Nusinersen 4 Publications Verification	DNA/RNA Synthesis	Neurological Disease
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .

Eteplirsen AVI 4658	Arp2/3 Complex	Metabolic Disease
Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide. Eteplirsen can be used for Duchenne muscular dystrophy research .

Nusinersen sodium 4 Publications Verification	DNA/RNA Synthesis	Neurological Disease
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .

DMT-2'fluoro-da(bz) amidite	Phosphoramidites DNA/RNA Synthesis Drug Intermediate	Others
DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

Volanesorsen sodium ISIS 304801 sodium	Apolipoprotein	Endocrinology
Volanesorsen (ISIS 304801) sodium is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen sodium is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .

Mipomersen 2 Publications Verification ISIS 301012 free base	Apolipoprotein HCV	Infection
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has *anti-HCV* effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

Tadnersen 1 Publications Verification BIIB078; IONIS-C9Rx	Ras Others	Neurological Disease
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

Pelacarsen sodium AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium	Apolipoprotein DNA/RNA Synthesis	Metabolic Disease
Pelacarsen sodium (ISIS 681257 sodium) is a GalNAc3-conjugated 2′-MOE-modified *antisense oligonucleotide*. Pelacarsen sodium reduces apo (a) .

UNC2383	Biochemical Assay Reagents	Endocrinology
UNC2383 is an oligonucleotide enhancer compound. UNC2383 can enhance the efficacy of antisense oligonucleotides (ASOs) and splice-switching oligonucleotides (SSOs). UNC2383 can be used in research of diseases involving impaired oligonucleotide delivery, such as cystic fibrosis .

Volanesorsen ISIS 304801	Apolipoprotein	Endocrinology
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .

Baliforsen ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx	Ser/Thr Kinase	Neurological Disease
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .

Diranersen IONIS-MAPTRx; BIIB080; ISIS 814907	Tau Protein	Neurological Disease
Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies .

Diranersen sodium IONIS-MAPTRx sodium; BIIB080 sodium; ISIS 814907 sodium	Tau Protein	Neurological Disease
Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies .

LNA-A(Bz) amidite	Phosphoramidites DNA/RNA Synthesis	Others
LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .

Sefaxersen sodium IONIS-FB-LRx sodium; RG6299 sodium; ISIS 696844 sodium	Complement System	Others
Sefaxersen sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .

Sapablursen IONIS-TMPRSS6-Lrx; ISIS 702843	TMPRSS6	Metabolic Disease
Sapablursen, an antisense oligonucleotide, is designed to reduce the production of TMPRSS6 resulting in increased expression of hepcidin, which is the key regulator of iron homeostasis. Sapablursen can be used in the research of blood diseases such as pol

Sefaxersen IONIS-FB-LRx; RG6299; ISIS 696844	Complement System	Others
Sefaxersen (IONIS-FB-LRx) is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen effectively reduces circulating levels of CFB. Sefaxersen can be used for geographic atrophy (GA) research .

(R/S)-Alicaforsen (R/S)-ISIS-2302	Integrin	Inflammation/Immunology
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.

Frenlosirsen ION-935918; ION251	IFNAR	Cancer
Frenlosirsen is an antisense oligonucleotide targeted to IRF4. It is used for study of relapsed/refractory multiple myeloma (RRMM).

Opemalirsen sodium AZD2373 sodium, ION-972190 sodium	Apolipoprotein	Metabolic Disease
Opemalirsen sodium is an antisense oligonucleotide targeted to apolipoprotein L1 (APOL1). It is used for the study of Kidney disorders.

Prexigebersen sodium BP1001 sodium	ERK	Cancer
Prexigebersen sodium is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).

Pelacarsen AKCEA-APO(a)-LRx; ISIS 681257; TQJ230	Apolipoprotein DNA/RNA Synthesis	Metabolic Disease
Pelacarsen (ISIS 681257) is a GalNAc3-conjugated 2′-MOE-modified *antisense oligonucleotide*. Pelacarsen reduces apo (a) .

Vupanorsen sodium IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium	ANGPTL	Metabolic Disease
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.

Brogidirsen NS 089; NCNP 02	DNA/RNA Synthesis	Neurological Disease
Brogidirsen (NS 089; NCNP 02) is a a dual-targeting antisense oligonucleotide. Brogidirsen can induce dystrophin protein experession. Brogidirsen can be used for the research of Duchenne muscular dystrophy .

Tau ASO-12 (murine) sodium	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

Volanesorsen scramble negative control ISIS 304801 scramble negative control	Apolipoprotein	Endocrinology
Volanesorsen scramble negative control is a negative control for volanesorsen (HY-145727) with the sequence: CAUGUTCUTCUGCATGUCAU. Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that can lower triglyceride levels and improve insulin resistance .

Mongersen sodium GED-0301 sodium	TGF-beta/Smad	Inflammation/Immunology
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .

Miravirsen sodium SPC-3649 sodium	MicroRNA	Infection
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .

Custirsen sodium OGX-011 sodium	Apoptosis	Cancer
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.

Tadnersen sodium 1 Publications Verification BIIB078 sodium; IONIS-C9Rx sodium	Ras	Neurological Disease
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

IONIS-GCCRRx sodium ISIS 426115 sodium	Glucocorticoid Receptor	Metabolic Disease
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

EZN-2968 sodium	HIF/HIF Prolyl-Hydroxylase	Cancer
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.

Scrambled Tadnersen Scrambled BIIB078; Scrambled IONIS-C9Rx	Ras	Neurological Disease
Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .

Rovanersen WVE-120101	Huntingtin	Neurological Disease
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .

Movronersen BIIB-101; ION-464	α-synuclein	Neurological Disease
Movronersen is an antisense oligonucleotide targeted to α-synuclein.

Nivudirsen	Dystrophin	Others
Nivudirsen is an antisense oligonucleotide that can promote the synthesis of functional dystrophin protein.

Erisonersen ION 717	Prion Protein	Infection
Erisonersen, an antisense oligonucleotide, is a prion protein synthesis reducer. It is used for the study of Prion disease.

Opemalirsen AZD2373, ION-972190	Apolipoprotein	Metabolic Disease
Opemalirsen is an antisense oligonucleotide targeted to apolipoprotein L1 (APOL1). It is used for the study of Kidney disorders.

Aganirsen	Insulin Receptor	Inflammation/Immunology
Aganirsen is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).

Vupanorsen IONIS ANGPT-L3Rx; ISIS 703802	ANGPTL	Metabolic Disease
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.

Obudanersen ION-582	E1/E2/E3 Enzyme	Others
Obudanersen is an antisense oligonucleotide targeted to ubiquitin protein ligase E3A-antisense transcript (UBE3A-ATS). It is used for the study of Angelman syndrome.

EZN-2968 RO 707179	HIF/HIF Prolyl-Hydroxylase	Cancer
EZN-2968 is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968, inhibits tumor cell growth.

gDIS3-13	Apoptosis	Cancer
gDIS3-13 is an antisense oligonucleotide targeting the DIS3 gene. gDIS3-13 can reduce cell growth and increase apoptosis in multiple myeloma (MM) .

Cat. No.	Product Name	Type

HY-112754AGL

DOTAP chloride (GMP Like)

1,2-Dioleoyl-3-trimethylammonium-propane chloride (GMP Like)

Fluorescent Dyes

DOTAP chloride (GMP Like) is the GMP Like class DOTAP chloride (HY-112754A). GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. DOTAP chloride is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride (GMP Like) can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .

HY-D145729F

FAM-Danvatirsen	Fluorescent Dyes
FAM-Danvatirsen is a FAM-labeled Danvatirsen (HY-145729). Danvatirsen is an antisense oligonucleotide targeting STAT3 that can be used in the study of cancer .

HY-D148410F

Cy5-Zorevunensen negative control Cy5-STK-001 negative control	Fluorescent Dyes
Cy5-Zorevunensen negative control (Cy5-STK-001 negative control) is an antisense oligonucleotide labeled with the fluorescent molecule Cy5, which can be used as a negative control for Zorevunersen (HY-148410) .

HY-150236

FITC-labeled Tominersen sodium	Fluorescent Dyes
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).

Cat. No.	Product Name	Type

HY-112754A

DOTAP chloride Maximum Cited Publications 14 Publications Verification 1,2-Dioleoyl-3-trimethylammonium-propane chloride	Biochemical Assay Reagents
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .

HY-21997

DMT-2'fluoro-da(bz) amidite	Biochemical Assay Reagents
DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .

HY-112754AGL

DOTAP chloride (GMP Like)

1,2-Dioleoyl-3-trimethylammonium-propane chloride (GMP Like)

Biochemical Assay Reagents

Cat. No.	Product Name	Target	Research Area

HY-P10567

Pip6a	Peptides	Others
Pip6a is an arginine-rich cell-penetrating peptide. Pip6a has the ability to deliver associated cargoes across the plasma and endosomal membranes and is stable to serum proteolysis. Pip6a is composed of a hydrophobic core region flanked on each side by arginine-rich domains containing β-alanine and aminohexanoyl spacers. Pip6a-conjugated morpholino phosphorodiamidate oligomer (PMO) dramatically enhanced antisense oligonucleotide (ASO) delivery into striated muscles of myotonic dystrophy (DM1) mice .

HY-40118

Boc-Pro-OMe Boc-L-proline methyl ester	Liposome	Others
Boc-Pro-OMe (Boc-L-proline methyl ester) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.

Cat. No.	Product Name	Chemical Structure

HY-132580S

Tofersen-d27

Tofersen-d₂₇ (BIIB067-d₂₇) is the deuterium labeled Tofersen (HY-132580). Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC₅₀ of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis.

HY-112754AS

DOTAP-d9 chloride
DOTAP-d₉ chloride is the deuterium labeled DOTAP chloride (HY-112754A). DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .

Cat. No.	Product Name		Classification

HY-112754A

DOTAP chloride Maximum Cited Publications 14 Publications Verification 1,2-Dioleoyl-3-trimethylammonium-propane chloride		Cationic Lipids
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .

HY-108764

Mipomersen sodium 2 Publications Verification ISIS 301012		Antisense Oligonucleotides
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has *anti-HCV* effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-112980

Nusinersen 4 Publications Verification		Antisense Oligonucleotides
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .

HY-108753

Eteplirsen AVI 4658		Antisense Oligonucleotides
Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide. Eteplirsen can be used for Duchenne muscular dystrophy research .

HY-112980A

Nusinersen sodium 4 Publications Verification		Antisense Oligonucleotides
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .

HY-21997

DMT-2'fluoro-da(bz) amidite		Phosphoramidites Adenine
DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .

HY-148647

Mipomersen 2 Publications Verification ISIS 301012 free base		Antisense Oligonucleotides
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has *anti-HCV* effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-132581

Tadnersen 1 Publications Verification BIIB078; IONIS-C9Rx		Antisense Oligonucleotides
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-151123A

Pelacarsen sodium AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium		Antisense Oligonucleotides
Pelacarsen sodium (ISIS 681257 sodium) is a GalNAc3-conjugated 2′-MOE-modified *antisense oligonucleotide*. Pelacarsen sodium reduces apo (a) .

HY-145725

Baliforsen sodium IONIS 598769 sodium; ISIS 598769 sodium		Antisense Oligonucleotides
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.

HY-132582

Diranersen IONIS-MAPTRx; BIIB080; ISIS 814907		Antisense Oligonucleotides
Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies .

HY-132582C

Diranersen sodium IONIS-MAPTRx sodium; BIIB080 sodium; ISIS 814907 sodium		Antisense Oligonucleotides
Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies .

HY-108753A

Eteplirsen sodium AVI 4658 sodium		Antisense Oligonucleotides
Eteplirsen (AVI 4658) sodium is a synthetic antisense oligonucleotide that induces dystrophin production. Eteplirsen (AVI 4658) sodium promotes exon 51 skipping in Duchenne muscular dystrophy patients and can be used in Duchenne muscular dystrophy research .

HY-W570887

LNA-A(Bz) amidite		Phosphoramidites Adenine
LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .

HY-159693A

ISIS 626112 sodium ION-626112 sodium		Antisense Oligonucleotides
ISIS 626112 (ION 626112) sodium is an antisense oligonucleotide targeting Malat1 .

HY-148370A

Sefaxersen sodium IONIS-FB-LRx sodium; RG6299 sodium; ISIS 696844 sodium		Antisense Oligonucleotides
Sefaxersen sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .

HY-177662

Sapablursen IONIS-TMPRSS6-Lrx; ISIS 702843		Antisense Oligonucleotides
Sapablursen, an antisense oligonucleotide, is designed to reduce the production of TMPRSS6 resulting in increased expression of hepcidin, which is the key regulator of iron homeostasis. Sapablursen can be used in the research of blood diseases such as pol

HY-148370

Sefaxersen IONIS-FB-LRx; RG6299; ISIS 696844		Antisense Oligonucleotides
Sefaxersen (IONIS-FB-LRx) is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen effectively reduces circulating levels of CFB. Sefaxersen can be used for geographic atrophy (GA) research .

HY-145728B

(R/S)-Alicaforsen (R/S)-ISIS-2302		Antisense Oligonucleotides
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.

HY-177632

Frenlosirsen ION-935918; ION251		Antisense Oligonucleotides
Frenlosirsen is an antisense oligonucleotide targeted to IRF4. It is used for study of relapsed/refractory multiple myeloma (RRMM).

HY-177653A

Opemalirsen sodium AZD2373 sodium, ION-972190 sodium		Antisense Oligonucleotides
Opemalirsen sodium is an antisense oligonucleotide targeted to apolipoprotein L1 (APOL1). It is used for the study of Kidney disorders.

HY-153495A

Prexigebersen sodium BP1001 sodium		Antisense Oligonucleotides
Prexigebersen sodium is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).

HY-151123

Pelacarsen AKCEA-APO(a)-LRx; ISIS 681257; TQJ230		Antisense Oligonucleotides
Pelacarsen (ISIS 681257) is a GalNAc3-conjugated 2′-MOE-modified *antisense oligonucleotide*. Pelacarsen reduces apo (a) .

HY-153497A

Vupanorsen sodium IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium		Antisense Oligonucleotides
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.

HY-147253

Brogidirsen NS 089; NCNP 02		Antisense Oligonucleotides
Brogidirsen (NS 089; NCNP 02) is a a dual-targeting antisense oligonucleotide. Brogidirsen can induce dystrophin protein experession. Brogidirsen can be used for the research of Duchenne muscular dystrophy .

HY-132582A

Tau ASO-12 (murine) sodium		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-145727C

Volanesorsen scramble negative control ISIS 304801 scramble negative control		Antisense Oligonucleotides
Volanesorsen scramble negative control is a negative control for volanesorsen (HY-145727) with the sequence: CAUGUTCUTCUGCATGUCAU. Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that can lower triglyceride levels and improve insulin resistance .

HY-145721A

Mongersen sodium GED-0301 sodium		Antisense Oligonucleotides
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .

HY-159693

ISIS 626112 ION-626112		Antisense Oligonucleotides
ISIS 626112 (ION 626112) is an antisense oligonucleotide targeting Malat1 .

HY-143230A

Custirsen sodium OGX-011 sodium		Antisense Oligonucleotides
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.

HY-132581A

Tadnersen sodium 1 Publications Verification BIIB078 sodium; IONIS-C9Rx sodium		Antisense Oligonucleotides
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-159695A

IONIS-GCCRRx sodium ISIS 426115 sodium		Antisense Oligonucleotides
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-158826A

EZN-2968 sodium		Antisense Oligonucleotides
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.

HY-145724A

Drisapersen sodium Kyndrisa sodium; GSK2402968A sodium; PRO051 sodium		Antisense Oligonucleotides
Drisapersen sodium, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.

HY-132581E

Scrambled Tadnersen Scrambled BIIB078; Scrambled IONIS-C9Rx		Antisense Oligonucleotides
Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .

HY-139788A

Fesomersen sodium ION-957943; BAY-2976217; IONIS-FXI-LRx sodium		Antisense Oligonucleotides
Fesomersen (sodium) is an antisense oligonucleotide designed to inhibit the production of Factor XI.

HY-177647

Movronersen BIIB-101; ION-464		Antisense Oligonucleotides
Movronersen is an antisense oligonucleotide targeted to α-synuclein.

HY-177649

Nivudirsen		Antisense Oligonucleotides
Nivudirsen is an antisense oligonucleotide that can promote the synthesis of functional dystrophin protein.

HY-177630

Erisonersen ION 717		Antisense Oligonucleotides
Erisonersen, an antisense oligonucleotide, is a prion protein synthesis reducer. It is used for the study of Prion disease.

HY-177653

Opemalirsen AZD2373, ION-972190		Antisense Oligonucleotides
Opemalirsen is an antisense oligonucleotide targeted to apolipoprotein L1 (APOL1). It is used for the study of Kidney disorders.

HY-177661

Salanersen BIIB115; ION306		Antisense Oligonucleotides
Salanersen is an antisense oligonucleotide targeted to survival motor neuron 2 (SMN2). It is used for the study of spinal muscular atrophy (SMA).

HY-153479

Aganirsen		Antisense Oligonucleotides
Aganirsen is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).

HY-153497

Vupanorsen IONIS ANGPT-L3Rx; ISIS 703802		Antisense Oligonucleotides
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.

HY-177651

Obudanersen ION-582		Antisense Oligonucleotides
Obudanersen is an antisense oligonucleotide targeted to ubiquitin protein ligase E3A-antisense transcript (UBE3A-ATS). It is used for the study of Angelman syndrome.

HY-158826

EZN-2968 RO 707179		Antisense Oligonucleotides
EZN-2968 is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968, inhibits tumor cell growth.

HY-171498

gDIS3-13		Antisense Oligonucleotides
gDIS3-13 is an antisense oligonucleotide targeting the DIS3 gene. gDIS3-13 can reduce cell growth and increase apoptosis in multiple myeloma (MM) .

HY-132585A

Vesleteplirsen sodium SRP-5051 sodium		Antisense Oligonucleotides
Vesleteplirsen (SRP-5051) sodium is a next-generation antisense oligonucleotide of peptide phosphorodiamidate morpholino oligomer (PPMO). Vesleteplirsen targets exon 51 skipping in Duchenne muscular dystrophy (DMD) .

HY-177662A

Sapablursen sodium IONIS-TMPRSS6-Lrx sodium; ISIS 702843 sodium		Antisense Oligonucleotides
Sapablursen sodium, an antisense oligonucleotide, is designed to reduce the production of TMPRSS6 resulting in increased expression of hepcidin, which is the key regulator of iron homeostasis. Sapablursen sodium can be used in the research of blood diseas

HY-153496

Sepofarsen QR 110		Antisense Oligonucleotides
Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.

HY-177647A

Movronersen sodium BIIB-101 sodium; ION-464 sodium		Antisense Oligonucleotides
Movronersen sodium is an antisense oligonucleotide targeted to α-synuclein.

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-112754AGL

DOTAP chloride (GMP Like) 1,2-Dioleoyl-3-trimethylammonium-propane chloride (GMP Like)	Liposome	Others
DOTAP chloride (GMP Like) is the GMP Like class DOTAP chloride (HY-112754A). GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. DOTAP chloride is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride (GMP Like) can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: