2. Search Result
Search Result
Results for "

protein sequence

" in MedChemExpress (MCE) Product Catalog:

102

Inhibitors & Agonists

4

Screening Libraries

3

Fluorescent Dyes

3

Biochemical Assay Reagents

59

Peptides

4

Inhibitory Antibodies

5

Natural
Products

28

Recombinant Proteins

20

Antibodies

17

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-15435
    CHAPS
    4 Publications Verification

    		 Exosomes Biochemical Assay Reagents Others
    CHAPS is a cholic acid-derived, sulfobetaine-type zwitterionic detergent and micelle-forming agent. CHAPS exhibits properties of weak cationic or nonionic surfactants in different solution systems, undergoes micellization, and forms small, loose hydrophilic aggregates that are temperature-dependent. CHAPS stabilizes mononucleosomes under different ionic strengths, reduces nucleosome sequence specificity, promotes sliding of histone cores along DNA, solubilizes Tamm-Horsfall protein to reduce its interference with urinary exosome isolation, and maintains vesicle structure and the activity of related proteins at the same time. CHAPS is used to recover native folded fusion proteins, enhance the binding capacity of GST fusion proteins, and restore GST enzyme activity. However, CHAPS cannot refold proteins denatured by urea, guanidine hydrochloride or heat, nor can it construct the structure of intrinsically disordered proteins. CHAPS is commonly used in research on the separation and purification of membrane proteins .
    CHAPS
  • HY-114164
    Thrombin (MW 37kDa)
    5+ Cited Publications

    		 Thrombin Neurological Disease
    Thrombin (MW 37kDa) is a Na +-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins.
    Thrombin (MW 37kDa)
  • HY-112163
    Zotatifin
    Maximum Cited Publications
    9 Publications Verification

    eFT226

    		 Eukaryotic Initiation Factor (eIF) SARS-CoV Apoptosis Infection Cancer
    Zotatifin (eFT226) is a potent, selective, and well-tolerated eIF4A inhibitor. Zotatifin promotes eIF4A binding to specific mRNA sequences with recognition motifs in the 5’-UTRs (IC50=2 nM) and interferes with the assembly of the eIF4F initiation complex . Zotatifin shows robust antiviral effects, it effectively reduces viral infectivity by inhibiting SARS-CoV-2 NP protein biogenesis (IC90=37 nM) . Zotatifin induces cell apoptosis .
    Zotatifin
  • HY-117695
    AQC
    5+ Cited Publications

    6-Aminoquinolyl-N-hydroxysccinimidyl carbamate

    		 Fluorescent Dye Others
    AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .
    AQC
  • HY-W040129
    Chromomycin A3
    1 Publications Verification

    		 DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase Infection Neurological Disease Cancer
    Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg 2+. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .
    Chromomycin A3
  • HY-130533
    ReAsH-EDT2

    		Fluorescent Dye Others
    ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λex=530 nm, λem=592 nm) .
    ReAsH-EDT2
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-W008806
    N-(3-Oxohexanoyl)-L-homoserine lactone

    OHHL; N-(3-Oxohexanoyl)homoserine lactone

    		 Bacterial Infection Inflammation/Immunology
    N-(3-Oxohexanoyl)-L-homoserine lactone (OHHL; N-(3-Oxohexanoyl)homoserine lactone) is a specific agonist of LuxR-type transcription factor CarR with a Kd of 1.8 μM. N-(3-Oxohexanoyl)-L-homoserine lactone activates CarR by inducing protein multimerization, promoting its binding to target DNA sequences in the carR-carA intergenic region, thereby upregulating the transcription of carbapenem biosynthesis genes. N-(3-Oxohexanoyl)-L-homoserine lactone acts as a quorum sensing signal molecule, enabling bacteria to coordinate the production of carbapenem antibiotics in a cell density-dependent manner. N-(3-Oxohexanoyl)-L-homoserine lactone is used to study bacterial quorum sensing mechanisms, especially the secondary metabolism and virulence factor regulatory pathways of Erwinia carotovora and Yersinia enterocolitica .
    N-(3-Oxohexanoyl)-L-homoserine lactone
  • HY-P4808
    PHF6

    		Amyloid-β Autophagy Neurological Disease
    PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .
    PHF6
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-15435A
    CHAPS hydrate
    4 Publications Verification

    		 Biochemical Assay Reagents Exosomes Others
    CHAPS hydrate is a cholic acid-derived, sulfobetaine-type zwitterionic detergent and micelle-forming agent. CHAPS hydrate exhibits properties of weak cationic or nonionic surfactants in different solution systems, undergoes micellization, and forms small, loose hydrophilic aggregates that are temperature-dependent. CHAPS hydrate stabilizes mononucleosomes under different ionic strengths, reduces nucleosome sequence specificity, promotes sliding of histone cores along DNA, solubilizes Tamm‑Horsfall protein to reduce its interference with urinary exosome isolation, and maintains vesicle structure and the activity of related proteins at the same time. CHAPS hydrate is used to recover native folded fusion proteins, enhance the binding capacity of GST fusion proteins, and restore GST enzyme activity. However, CHAPS hydrate cannot refold proteins denatured by urea, guanidine hydrochloride or heat, nor can it construct the structure of intrinsically disordered proteins. CHAPS hydrate is commonly used in research on the separation and purification of membrane proteins .
    CHAPS hydrate
  • HY-P3732
    RGD-4C

    		Integrin Cancer
    RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .
    RGD-4C
  • HY-P1907
    Human Papillomavirus (HPV) E7 protein (49-57)

    		HPV Cancer
    Human Papillomavirus (HPV) E7 protein (49-57) is a cytotoxic T lymphocyte (CTL) epitope peptide derived from HPV16 E7 protein (sequence: RAHYNIVTF). Human Papillomavirus (HPV) E7 protein (49-57) induces E749-57-specific CTL responses. Human Papillomavirus (HPV) E7 protein (49-57) can be used for the research of cervical cancer .
    Human Papillomavirus (HPV) E7 protein (49-57)
  • HY-P3509
    PNC-28

    		MDM-2/p53 Cancer
    PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .
    PNC-28
  • HY-P4279
    Ovalbumin (154-159)

    		Angiotensin-converting Enzyme (ACE) Cholinesterase (ChE) Cardiovascular Disease
    Ovalbumin (154-159) is a protein fragment consisting of residues 154-159 of chicken ovalbumin. Ovalbumin (154-159) is also a poorly conserved sequence (Thr-Asn-Gly-Ile-Ile-Arg) in the α-subunit of the Torpedo acetylcholine receptor, located within the α150-164 epitope region, and exhibits significant angiotensin-converting enzyme (ACE) inhibitory activity .
    Ovalbumin (154-159)
  • HY-P0315
    Crosstide
    2 Publications Verification

    		 Akt Others
    Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.
    Crosstide
  • HY-P10719
    Pepinh-MYD

    		MyD88 Infection Inflammation/Immunology
    Pepinh-MYD is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. It holds potential for studying the role of MyD88 in viral infections .
    Pepinh-MYD
  • HY-114164C
    Thrombin, Pig blood
    5+ Cited Publications

    		 Protease Activated Receptor (PAR) Thrombin Cardiovascular Disease
    Rabbit Thrombin is a Na +-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .
    Thrombin, Pig blood
  • HY-E70370
    hrv 3c Protease

    		Virus Protease Others
    hrv 3c Protease is a protease originated from human rhinoviruses. hrv 3c Protease recognizes the sequence LEVLFQGP and cleaves precisely between the Q and GP residues. hrv 3c Protease can be used to remove additional tags from the target proteins .
    hrv 3c Protease
  • HY-P3051
    CKS-17

    		Reverse Transcriptase Inflammation/Immunology
    CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .
    CKS-17
  • HY-153898
    rTRD01

    		Amyloid-β Neurological Disease
    rTRD01 is an orally active, specific TDP-43 binder that targets the RRM1 and RRM2 domains of TDP-43. rTRD01 partially disrupts the interaction between TDP-43 and c9orf72 repeat RNA, but does not affect the binding of TDP-43 to canonical binding sequences. rTRD01 exhibits significant neuroprotective effects in zebrafish models, improves motor function and protects against paraquat (a widely used herbicide)-induced neurodegeneration, with no teratogenicity at high concentrations. rTRD01 is not a general antioxidant and cannot counteract Rotenone (HY-B1756)-induced neuronal death. rTRD01 can be used to study amyotrophic lateral sclerosis and other TDP-43 proteinopathies .
    rTRD01
  • HY-100758
    FUBP1-IN-1
    2 Publications Verification

    		 DNA/RNA Synthesis Cancer
    FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
    FUBP1-IN-1
  • HY-P3509A
    PNC-28 acetate

    		MDM-2/p53 Cancer
    PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .
    PNC-28 acetate
  • HY-132590A
    Revusiran sodium

    ALN-TTRSC sodium

    		 Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Revusiran (ALN-TTRSC) sodium is an RNA interference agent targeting the mRNA of transthyretin (Transthyretin, TTR). Revusiran sodium mediates sequence-specific degradation of TTR mRNA through RNA interference, reduces the synthesis of TTR protein, binds to GalNAc ligands, and is taken up by hepatocytes via the asialoglycoprotein receptor. Revusiran sodium exhibits favorable nonclinical safety profiles. Revusiran sodium can be used in studies related to transthyretin-mediated amyloidosis .
    Revusiran sodium
  • HY-E70528
    HRV-3C protease fuses with GST

    		Biochemical Assay Reagents Others
    HRV-3C protease fuses with GST is a recombinant protease fused with HRV-3C protease and GST, which recognizes the LEVLFQGP polypeptide sequence. HRV-3C protease fuses with GST precisely cleaves between glutamine and glycine-proline residues to remove fusion tags from target proteins. HRV-3C protease fuses with GST exhibits cleavage activity both in vitro in silkworm fat body lysates and in vivo in silkworm larval fat bodies, and achieves functional expression in E. coli and silkworm-baculovirus expression systems. HRV-3C protease fuses with GST can be applied to recombinant protein-related research .
    HRV-3C protease fuses with GST
  • HY-153843
    RNA Aptamer Corn sodium

    		Biochemical Assay Reagents Others
    RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)
    RNA Aptamer Corn sodium
  • HY-122578
    P53R3

    		MDM-2/p53 Cancer
    P53R3 is a potent p53 reactivator and restores sequence-specific DNA binding of p53 hot spot mutants, including p53 R175H, p53 R248W and p53 R273H. P53R3 induces p53-dependent antiproliferative effects with much higher specificity than PRIMA-1. P53R3 enhances the recruitment of wild-type p53 and p53 M237I to several target gene promoters. P53R3 strongly enhances the mRNA, total protein and cell surface expression of the death receptor death receptor 5 (DR5). P53R3 is used for cancer research .
    P53R3
  • HY-148062
    RSS0680

    		PROTACs CDK AAK1 Cyclin G-associated Kinase (GAK) Salt-inducible Kinase (SIK) LIM Kinase (LIMK) Wee1 SnRK Others
    RSS0680 is a small noncoding RNA (sRNA) targeting the mRNA ribosome binding site (RBS) and a PROTAC with protein kinase degradation activity (Pink: FLT3-IN-17 (HY-148070); Black: Linker (HY-W041970); Blue: E3 ligase Ligand (HY-112078)). RSS0680 competitively binds to RBS through the conserved CCUCCUCCC anti-Shine-Dalgarno (aSD) sequence and inhibits the translation initiation of target genes. RSS0680 can interact with the DUF1127 protein CcaF1, regulate its own stability and participate in bacterial oxidative stress defense, enhancing the host's resistance to heat shock and oxidative damage by affecting pathways such as C1 metabolism and pyruvate dehydrogenase complex. RSS0680 degrades AAK1, CDK1, CDK16, CDK2, CDK4, CDK6, EIF2AK4, GAK, LATSl, LIMK2, MAPK6, MAPKAPK5, MARK2, MARK4, MKNK2, NEK9, RPS6KB1, SIK2, SNRK, STK17A, STK17B, STK35, and WEEl. RSS0680 can be used to study diseases or disorders mediated by aberrant kinase activity and regulatory mechanisms of noncoding RNAs in α-proteobacteria[1][2].
    RSS0680
  • HY-P4808A
    PHF6 TFA

    		Amyloid-β Autophagy Neurological Disease
    PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .
    PHF6 TFA
  • HY-P5430
    DYRKtide

    		DYRK Others
    DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)
    DYRKtide
  • HY-114164D
    Rat Thrombin
    5+ Cited Publications

    		 Thrombin Cardiovascular Disease
    Rat Thrombin is a Na +-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .
    Rat Thrombin
  • HY-P10532
    Myelin basic protein, MBP (68-86)

    		PKC Others Inflammation/Immunology
    Myelin basic protein, MBP (68-86) is the portion of the 68th to 86th amino acid residues in the MBP protein sequence. Myelin basic protein, MBP (68-86) can act as an autoantigen, triggering the immune system to attack its own myelin. Myelin basic protein, MBP (68-86) is used as one of the immunogens in the experimental autoimmune encephalomyelitis (EAE) animal model to study immune responses associated with multiple sclerosis (MS) .
    Myelin basic protein, MBP (68-86)
  • HY-16967
    MM41

    		G-quadruplex Bcl-2 Family Ras Caspase Cancer
    MM41 is a quadruplex-interacting compound. MM41 binds tightly to quadruplexes encoded in the promoter sequences of the BCL-2 and k-RAS genes. MM41 reduces BCL-2 and k-RAS protein levels, increases caspase 3. MM41 has antitumor effects against pancreatic cancer .
    MM41
  • HY-P10471A
    MPSD TFA

    MARCKS-ED TFA

    		 MARCKS PKC Others
    MPSD TFA (MARCKS-ED TFA) is the TFA salt form of MPSD (HY-P10471). MPSD TFA is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD TFA can sense membrane curvature and recognize phosphatidylserine. MPSD TFA can be utilized as biological probe to study membrane shape and lipid composition .
    MPSD TFA
  • HY-DY1070
    AQC (solution)

    		Fluorescent Dye Others
    AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) (solution) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .
    Solvent and concentration: DMSO: 10 mM
    The 1 mL volume is defined as the base specification. All larger sizes correspond to incremental volumes of this base.
    AQC (solution)
  • HY-P4933
    Tau Peptide (255-314) (Repeat 2 Domain) (human)

    Tau-F protein (255-314)

    		 Tau Protein Neurological Disease
    Tau Peptide (255-314) (Repeat 2 Domain) (human) (Tau-F protein (255-314)) is a polypeptide. Tau Peptide (255-314) (human) is the 255-314 fragment of Tau-F (also known as Tau-4, the 2N4 isoform), a major isoform of the Tau protein. Tau Peptide (255-314) (human) contains two core driving sequences for Tau aggregation, namely PHF6* (275-280, VQIINK) and PHF6 (306-311, VQIVYK), and spans the C-terminal half of repeat domain R1, the entire repeat domain R2, and the N-terminal half of repeat domain R3 within the microtubule-binding region (MTBR).
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
  • HY-P10719A
    Pepinh-MYD TFA

    		MyD88 Infection Inflammation/Immunology
    Pepinh-MYD TFA is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD TFA interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. Pepinh-MYD TFA holds potential for studying the role of MyD88 in viral infections .
    Pepinh-MYD TFA
  • HY-P2929B
    PNGase F (Immobilized, Microspin)

    		Glycosidase Others
    PNGase F (Immobilized, Microspin) is a resin in which PNGase F (peptide N-glycosidase F) is covalently coupled to agarose beads, and it is used to remove N-glycans from antibodies, fusion proteins and other N-glycosylated proteins. The enzyme is recombinantly expressed in Escherichia coli, with its sequence derived from Flavobacterium meningsepticum .
    PNGase F (Immobilized, Microspin)
  • HY-P10471E
    MPSD control peptide TFA

    MARCKS-ED control peptide TFA

    		 MARCKS Others
    MPSD control peptide (MARCKS-ED control peptide) TFA is the control peptide of MPSD (HY-P10471). MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS) .
    MPSD control peptide TFA
  • HY-E70565
    O-Glycoprotease

    		Endonuclease Inflammation/Immunology
    O-Glycoprotease is an O-glycoprotein-specific endoprotease that catalyzes the hydrolysis of peptide bonds directly adjacent to the O-polymer in native mucin-type O-glycosylated proteins. O-Glycoprotease sequence is from Akkermansia muciniphila, recombinantly expressed in E.coli, with a 6×His tag at the C-terminus.
    The enzyme maintains high activity between pH 5.5-7.5 and is resistant to 1M NaCl, but is highly sensitive to EDTA (0.5 mM EDTA) and can be inhibited by Zn 2+.
    O-Glycoprotease
  • HY-P990088
    Sotiburafusp alfa

    		VEGFR PD-1/PD-L1 Cardiovascular Disease
    Sotiburafusp alfa is a bispecific fusion protein, which is a humanized VEGFR-1 extracellular domain fragment (129-228, 1-100 in the current sequence) fused via the peptide linker 101GGSGGSGGSGGSGGS 115 to the N-terminus of the heavy chain (116-564) of a humanized IgG1-kappa anti-human PD-L1 heavy chain variant L352>A, L353>A. Sotiburafusp alfa also functions as a PD-L1 inhibitor and a VEGF inhibitor .
    Sotiburafusp alfa
  • HY-P1849A
    JAG-1, scrambled TFA
    1 Publications Verification

    scJag-1 TFA

    		 Notch Cardiovascular Disease
    JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .
    JAG-1, scrambled TFA
  • HY-P3935
    Arg-Gly-Tyr-Ser-Leu-Gly

    		Ser/Thr Kinase Cancer
    Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .
    Arg-Gly-Tyr-Ser-Leu-Gly
  • HY-P11219
    TAT-PDHPS1

    		YAP Cancer
    TAT-PDHPS1 is a YAP inhibitor composed of the endogenous peptide PDHPS1 and the cell-penetrating peptide sequence TAT. PDHPS1 binds to protein phosphatase 2 phosphatase activator (PTPA), an essential activator of protein phosphatase 2A (PP2A), leading to increased YAP phosphorylation, which inactivates YAP and suppresses the expression of its downstream target genes. TAT-PDHPS1 is potentially useful in ovarian cancer research .
    TAT-PDHPS1
  • HY-101931
    hVEGF-IN-1

    		VEGFR Cancer
    hVEGF-IN-1, a quinazoline derivative, could specifically bind to the G-rich sequence in the internal ribosome entry site A (IRES-A) and destabilize the G-quadruplex structure. hVEGF-IN-1 binds to the IRES-A (WT) with a Kd of 0.928 μM in SPR experiments. hVEGF-IN-1 could hinder tumor cells migration and repress tumor growth by decreasing VEGF-A protein expression .
    hVEGF-IN-1
  • HY-132590
    Revusiran

    ALN-TTRSC

    		 Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Revusiran (ALN-TTRSC) is an RNA interference agent targeting the mRNA of transthyretin (Transthyretin, TTR). Revusiran mediates sequence-specific degradation of TTR mRNA through RNA interference, reduces the synthesis of TTR protein, binds to GalNAc ligands, and is taken up by hepatocytes via the asialoglycoprotein receptor. Revusiran exhibits favorable nonclinical safety profiles. Revusiran can be used in studies related to transthyretin-mediated amyloidosis .
    Revusiran
  • HY-P10055
    PSMA targeting peptide

    PSMA-1

    		 PSMA Cancer
    PSMA-1 is a PSMA targeting peptide (GRFLTGGTGRLLRIS) and can be used for for targeted delivery of glucose-regulated protein (GRP)-silencing siRNAs in PCa cells. PSMA-1 is selected and polyarginine sequences R6 or R9 were added at the C terminus to generate the CTPs. FITC labeling of the peptide with an aminohexanoic acid (Ahx) linker at the N terminus produced FITC-PSMA-1，to track PSMA binding on PCa cells .
    PSMA targeting peptide
  • HY-P10553
    ARF(26–44), cell-permeable

    		Apoptosis Cancer
    ARF(26–44), cell-permeable is a cell-penetrating peptide derived from a specific amino acid sequence of the p14ARF tumor suppressor protein. As a functional inhibitor of FoxM1, ARF(26–44) cell-permeable shows significant anti-tumor activity in the treatment of mouse hepatocellular carcinoma (HCC), significantly increasing tumor cell apoptosis and reducing tumor cell proliferation and angiogenesis. ARF(26–44), cell-permeable can be used in research on tumor therapy .
    ARF(26–44), cell-permeable
  • HY-P5325A
    Bid BH3 (80-99) acetate

    		Bcl-2 Family Others
    Bid BH3 (80-99) acetate is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)
    Bid BH3 (80-99) acetate
  • HY-P5325
    Bid BH3 (80-99)

    		Bcl-2 Family Others
    Bid BH3 (80-99) is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)
    Bid BH3 (80-99)

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: