2. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

viral DNA

" in MedChemExpress (MCE) Product Catalog:

142

Inhibitors & Agonists

1

Screening Libraries

6

Biochemical Assay Reagents

3

Peptides

1

Inhibitory Antibodies

19

Natural
Products

8

Isotope-Labeled Compounds

1

Click Chemistry

14

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-104077
    Remdesivir
    Maximum Cited Publications
    214 Publications Verification

    GS-5734

    		 DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir
  • HY-W250110E
    Polyethylenimine (branched) (MW 25000)

    PEI (branched) (MW 25000)

    		 Environmental Pollutants DNA Alkylator/Crosslinker Biochemical Assay Reagents Others
    Polyethylenimine (branched) is a commonly used non-viral DNA transfection reagent. Polyethylenimine (branched) (MW 25000) binds to plasmid DNA .
    Polyethylenimine (branched) (MW 25000)
  • HY-B0307
    Idoxuridine
    5+ Cited Publications

    5-Iodo-2′-deoxyuridine; 5-IUdR; IdUrd

    		 DNA/RNA Synthesis Phosphatase Orthopoxvirus Infection Cancer
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM . Idoxuridine shows anti-orthopoxvirus activity.
    Idoxuridine
  • HY-17438
    Cidofovir
    Maximum Cited Publications
    14 Publications Verification

    GS 0504; HPMPC; (S)-HPMPC

    		 CMV Apoptosis DNA/RNA Synthesis Orthopoxvirus Endogenous Metabolite Infection Cancer
    Cidofovir (GS 0504) is an acyclic monophosphate nucleotide analogue and CMV inhibitor with antiviral activity. Cidofovir inhibits cytomegalovirus (CMV) replication by selectively inhibiting viral DNA polymerase. Cidofovir induces apoptosis and can be used in studies of AIDS cytomegalovirus retinitis, herpes, and cancer . Cidofovir also has anti-orthopoxvirus and anti-variola activities .
    Cidofovir
  • HY-15233
    Letermovir
    15+ Cited Publications

    AIC246; MK-8228

    		 CMV Infection Cancer
    Letermovir (AIC246) is a potent inhibitor of CMV, which targets the viral terminase complex and remains active against virus resistant to DNA polymerase inhibitors.
    Letermovir
  • HY-N0057
    3,4-Dicaffeoylquinic acid
    5+ Cited Publications

    3,4-Di-O-caffeoylquinic acid; Isochlorogenic acid B

    		 Glycosidase Influenza Virus Apoptosis Endogenous Metabolite Infection Cancer
    3,4-Dicaffeoylquinic acid (3,4-Di-O-caffeoylquinic acid), naturally isolated from Laggera alata, has antioxidative, DNA protective, neuroprotective and hepatoprotective properties. 3,4-Dicaffeoylquinic acid exerts apoptosis-mediated cytotoxicity and α-glucosidase inhibitory effects. 3,4-Dicaffeoylquinic acid possesses a unique mechanism of anti-influenza viral activity, that is, enhancing viral clearance by increasing TRAIL .
    3,4-Dicaffeoylquinic acid
  • HY-B1318
    Foscarnet sodium
    3 Publications Verification

    Trisodium phosphonoformate; Phosphonoformic acid trisodium salt

    		 DNA/RNA Synthesis Infection
    Foscarnet sodium (Trisodium phosphonoformate) is a viral DNA polymerase activity inhibitor, leading to reversible suppression of viral replication. Foscarnet sodium is an antiherpesvirus agent used in cytomegalovirus retinitis .
    Foscarnet sodium
  • HY-B0277
    Vidarabine
    5+ Cited Publications

    Ara-A; Adenine Arabinoside; 9-β-D-Arabinofuranosyladenine

    		 Apoptosis Fungal Reactive Oxygen Species (ROS) EBV HSV Antibiotic DNA/RNA Synthesis Drug Metabolite Infection Cancer
    Vidarabine (Ara-A) is a nucleoside antibiotic isolated from Streptomyces, and a metabolite of Vidarabine phosphate (HY-B0277A). Vidarabine selectively inhibits viral DNA polymerase and cellular ribonucleotide reductase, thereby blocking viral replication. Vidarabine phosphate also exhibits antifungal activity, induces late-stage cellular apoptosis, and causes cell cycle arrest. Vidarabine phosphate can be used in research related to severe chronic active Epstein-Barr virus (EBV) infection, herpes infection, and candidiasis .
    Vidarabine
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-N8332
    Bile extract

    Ox bile extract

    		 Bacterial DNA/RNA Synthesis Infection
    Bile extract (Ox bile extract) is a complex mixture of substances, containing bile acids, cholesterol, and bilirubin. Bile extract has antimicrobial activity and can induce DNA damage and degrade viral and bacterial membranes. Bile extract can be used in bacterial culture media as a selective inhibitor for the isolation and identification of pathogens .
    Bile extract
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B0277A
    Vidarabine phosphate

    ara-AMP; ara-A 5'-monophosphate

    		 EBV HSV Fungal DNA/RNA Synthesis Apoptosis Drug Intermediate Reactive Oxygen Species (ROS) Infection
    Vidarabine phosphate (ara-AMP; ara-A 5'-monophosphate) is a purine nucleoside antiviral agent and a prodrug of Vidarabine (HY-B0277). Vidarabine phosphate is rapidly converted into the antiviral active Vidarabine in vivo, which selectively inhibits viral DNA polymerase and cellular ribonucleotide reductase, thereby blocking viral replication. Vidarabine phosphate also exhibits antifungal activity, induces late-stage cellular apoptosis, and causes cell cycle arrest. Vidarabine phosphate can be used in research related to severe chronic active Epstein-Barr virus (EBV) infection, herpes infection, and candidiasis .
    Vidarabine phosphate
  • HY-128744
    Phosphonoacetic acid
    2 Publications Verification

    		 Endogenous Metabolite Orthopoxvirus HSV DNA/RNA Synthesis Infection
    Phosphonoacetic acid is an endogenous metabolite and antiviral agent. Phosphonoacetic acid is active against orthopoxviruses and herpes viruses. Phosphonoacetic acid can inhibit HSV DNA synthesis and virus-specific DNA polymerase activity, and affect the synthesis of late viral proteins .
    Phosphonoacetic acid
  • HY-N0093
    Ancitabine hydrochloride
    1 Publications Verification

    Cyclocytidine hydrochloride; Cyclo-CMP hydrochloride; Cyclo-C

    		 Autophagy CMV DNA/RNA Synthesis Infection Cancer
    Ancitabine hydrochloride is a cytarabine derivative that inhibits viral replication. Ancitabine hydrochloride blocks vaccinia virus DNA replication, the progression of viral protein synthesis from early to late stages, and one-step growth of vaccinia virus. Ancitabine hydrochloride is applicable to research related to vaccinia virus infection, leukemia, human cytomegalovirus infection and colorectal cancer .
    Ancitabine hydrochloride
  • HY-131606B
    Cidofovir diphosphate tritriethylamine

    		Drug Metabolite DNA/RNA Synthesis Infection
    Cidofovir diphosphate tri triethylamine is an active intracellular metabolite of Cidofovir. Cidofovir diphosphate tri triethylamine is a selective inhibitor of viral DNA polymerases with Ki values of 6.6, 0.86 and 1.4 μM for HCMV, HSV-1 and HSV-2 DNA polymerase, respectively .
    Cidofovir diphosphate tritriethylamine
  • HY-113431
    Arabinosylhypoxanthine

    		Nucleoside Antimetabolite/Analog HSV DNA/RNA Synthesis Infection
    Arabinosylhypoxanthine is a purine nucleoside analog. Arabinosylhypoxanthine selectively inhibits viral DNA synthesis. Arabinosylhypoxanthine exhibits anti-HSV activity. Arabinosylhypoxanthine can be used in studies related to herpes simplex virus infection .
    Arabinosylhypoxanthine
  • HY-126437I
    Poly-L-lysine hydrobromide (MW 1000-5000)

    		Biochemical Assay Reagents DNA Alkylator/Crosslinker Amino Acid Derivatives Cancer
    Poly-L-lysine hydrobromide (MW 1000-5000) is a homopolymer of L-lysine and a polycationic non-viral gene delivery vector. Poly-L-lysine hydrobromide (MW 1000-5000) forms complexes with plasmid DNA. Poly-L-lysine hydrobromide (MW 1000-5000) is applicable to relevant research on lung cancer .
    Poly-L-lysine hydrobromide (MW 1000-5000)
  • HY-13859
    Clevudine
    1 Publications Verification

    L-FMAU

    		 HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
    Clevudine
  • HY-104077S1
    Remdesivir-d4

    GS-5734-d4

    		 DNA/RNA Synthesis Isotope-Labeled Compounds SARS-CoV Infection
    Remdesivir-d4 (GS-5734-d4) is deuterium labeled Remdesivir (HY-104077). Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir-d4
  • HY-137697D
    ddCTP trisodium solution (100 mM)

    		HIV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Drug Metabolite HIV Protease Infection
    ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP trisodium solution (100 mM)
  • HY-W013256
    Foscarnet trisodium hexahydrate
    3 Publications Verification

    Trisodium phosphonoformate hexahydrate; Phosphonoformic acid trisodium salt hexahydrate

    		 DNA/RNA Synthesis Infection
    Foscarnet trisodium hexahydrate (Trisodium phosphonatoformate hexahydrate) is a viral DNA polymerase activity inhibitor, leading to reversible suppression of viral replication. Foscarnet trisodium hexahydrate is an antiherpesvirus agent used in cytomegalovirus retinitis .
    Foscarnet trisodium hexahydrate
  • HY-N8533
    Sodium Camptothecin

    		DNA/RNA Synthesis Infection Cancer
    Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .
    Sodium Camptothecin
  • HY-19743
    Triazavirin
    1 Publications Verification

    		 Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis Infection
    Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza .
    Triazavirin
  • HY-157993
    SAG-524

    		HBV Infection
    SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
    SAG-524
  • HY-17422S1
    Acyclovir-d4

    Aciclovir-d4; Acycloguanosine-d4

    		 Isotope-Labeled Compounds HSV Bacterial Apoptosis Antibiotic Infection Cancer
    Acyclovir-d4 is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination . Acyclovir prevents bacterial infections during induction therapy for acute leukaemia .
    Acyclovir-d4
  • HY-W012311
    3′-Deoxythymidine

    2′,3′-Dideoxythymidine; ddThd

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Infection
    3′-Deoxythymidine (2′,3′-Dideoxythymidine), a nucleoside analog, inhibits eukaryotic cellular and viral DNA polymerases, and inhibits retrovirus infection in some cells .
    3′-Deoxythymidine
  • HY-160224
    dsVACV-70mer sodium

    		STING IFNAR Inflammation/Immunology
    dsVACV-70mer (sodium) is a 70 bp double-stranded oligonucleotide containing viral DNA motifs derived from vaccinia virus DNA. dsVACV-70mer (sodium) has potently induces IFN-β via a STING-dependent manner .
    dsVACV-70mer sodium
  • HY-N6666
    Vidarabine monohydrate
    5+ Cited Publications

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis HSV VZV CMV EBV Infection
    Vidarabine monohydrate is a Purine nucleoside derivative and Antiviral agent. The triphosphate derivative of Vidarabine monohydrate competitively inhibits DNA polymerase, incorporates into the terminus of elongating DNA molecules, and interferes with the early steps of viral DNA synthesis. Vidarabine monohydrate inhibits the replication of herpes simplex virus, varicella-zoster virus, cytomegalovirus, Epstein-Barr virus and vaccinia virus, reduces viral shedding, and accelerates skin healing. Vidarabine monohydrate is metabolized to arabinosyl hypoxanthine, causes minimal impairment of corneal wound healing in rabbit models, and is associated with recurrence of herpes simplex encephalitis. Vidarabine monohydrate can be used in the research of herpetic keratoconjunctivitis, herpes simplex encephalitis, herpetic uveitis, and chronic active hepatitis associated with hepatitis B virus .
    Vidarabine monohydrate
  • HY-P0328
    VSV-G tag Peptide
    1 Publications Verification

    		 VSV Infection
    VSV-G tag Peptide is a 11 amino acid peptide derived from the Vesicular Stomatitis viral glycoprotein. VSV-G tag Peptide can integrate into the cell membranes of animal cells, induce cell fusion, and significantly enhance the efficiency of DNA transfection into animal cells. VSV-G tag Peptide can be used for research on drug delivery .
    VSV-G tag Peptide
  • HY-137697
    ddCTP

    		Nucleoside Antimetabolite/Analog DNA/RNA Synthesis HIV Protease HIV Drug Metabolite Infection
    ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP
  • HY-W269306
    Bonaphthone

    		DNA/RNA Synthesis Influenza Virus Infection
    Bonaphthone is an antiviral agent with anti-DNA and -RNA viral activities .
    Bonaphthone
  • HY-142028A
    Acyclovir triphosphate sodium (100 mM)

    AcycloGTP sodium (100 mM)

    		 DNA/RNA Synthesis Nucleoside Antimetabolite/Analog HIV Reverse Transcriptase Infection
    Acyclovir triphosphate (Synonyms: AcycloGTP) sodium is a Acyclovir (HY-17422) derivative that competitively inhibits viral DNA polymerase by acting as an analog to deoxyguanosine triphosphate (dGTP). Acyclovir triphosphate (sodium) (100 mM) is an inhibitor of HIV-1 reverse transcriptase. Acyclovir triphosphate (sodium) (100 mM) causes termination of viral DNA synthesis .
    Acyclovir triphosphate sodium (100 mM)
  • HY-108261
    Tomeglovir

    BAY 38-4766

    		 CMV Infection
    Tomeglovir is a potent anti-CMV agent, inhibiting processing of viral DNA-concatemers, with IC50s of 0.34 μM and 0.039 μM for HCMV and MCMV.
    Tomeglovir
  • HY-W353804
    2′-Deoxy-β-L-uridine

    		Nucleoside Antimetabolite/Analog Infection
    2'-Deoxy-β-L-uridine is a nucledside analogue and a specific substrate for the viral enzyme, shows no stereospecificity against herpes simplex 1 (HSV1) thymidine kinase (TK). 2′-Deoxy-β-L-uridine exerts antiviral activity via the interation of 5'-triphosphates with the viral DNA polymerase .
    2′-Deoxy-β-L-uridine
  • HY-131605B
    Ganciclovir triphosphate disodium

    GCV-TP disodium

    		 CMV DNA/RNA Synthesis Infection Cancer
    Ganciclovir triphosphate (GCV-TP) disodium is a synthetic 2'-deoxyguanosine analog with activity in inhibiting human cytomegalovirus (CMV) replication. Ganciclovir triphosphate disodium is effective against CMV infection by binding to viral DNA polymerase and interfering with viral DNA synthesis. Ganciclovir triphosphate disodium has an IC50 of 0.01 μM against CMV strains from humans, monkeys, mice, and guinea pigs. Ganciclovir triphosphate disodium has also been used in gene-directed enzyme prodrug inhibition for cancer inhibition .
    Ganciclovir triphosphate disodium
  • HY-171692
    G3-YSD

    		Cyclic GMP-AMP Synthase IFNAR STING Infection
    G3-YSD is a cGAS agonist. G3-YSD directly interacts with cGAS to enhance its enzymatic activity, promote the conversion of ATP and GTP into cGAMP, and trigger STING-dependent IFN-α/β secretion. G3-YSD acts as a viral mimic to replace actual viral DNA . G3-YSD is applicable to research related to long COVID and type 1 human immunodeficiency virus infection .
    G3-YSD
  • HY-104077S
    Remdesivir-d5
    2 Publications Verification

    GS-5734-d5

    		 Isotope-Labeled Compounds DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir-d5 (GS-5734-d5) is a deuterium labeled Remdesivir (HY-104077). Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir-d5
  • HY-100028
    AT-130
    2 Publications Verification

    		 HBV DNA/RNA Synthesis Infection Cancer
    AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .
    AT-130
  • HY-148170
    L-I-OddU

    		EBV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Infection
    L-I-OddU, a L-5'-halo- dioxolane nucleoside analogue, is a potent and selective anti-Epstein-Barr virus (EBV) agent with an EC50 value of 0.03μM. L-I-OddU has low cytotoxicity with a CC50 value of 1000 nM. L-I-OddU has antiviral activity by suppressing replicative EBV DNA and viral protein synthesis .
    L-I-OddU
  • HY-131605
    Ganciclovir triphosphate

    GCV-TP

    		 Endogenous Metabolite CMV DNA/RNA Synthesis Infection Cancer
    Ganciclovir triphosphate (GCV-TP) is a synthetic 2'-deoxyguanosine analog with activity in inhibiting human cytomegalovirus (CMV) replication. Ganciclovir triphosphate is effective against CMV infection by binding to viral DNA polymerase and interfering with viral DNA synthesis. Ganciclovir triphosphate has an IC50 of 0.01 μM against CMV strains from humans, monkeys, mice, and guinea pigs. Ganciclovir triphosphate has also been used in gene-directed enzyme prodrug inhibition for cancer inhibition .
    Ganciclovir triphosphate
  • HY-131606
    Cidofovir diphosphate

    		HSV CMV DNA/RNA Synthesis Infection
    Cidofovir diphosphate is an active intracellular metabolite of Cidofovir. Cidofovir diphosphate is a selective inhibitor of viral DNA polymerases with Ki values of 6.6, 0.86 and 1.4 μM for HCMV, HSV-1 and HSV-2 DNA polymerase, respectively .
    Cidofovir diphosphate
  • HY-W013256R
    Foscarnet trisodium hexahydrate (Standard)

    Trisodium phosphonoformate hexahydrate (Standard); Phosphonoformic acid trisodium salt hexahydrate (Standard)

    		 Reference Standards DNA/RNA Synthesis Infection
    Foscarnet (trisodium hexahydrate) (Standard) is the analytical standard of Foscarnet (trisodium hexahydrate). This product is intended for research and analytical applications. Foscarnet trisodium hexahydrate (Trisodium phosphonatoformate hexahydrate) is a viral DNA polymerase activity inhibitor, leading to reversible suppression of viral replication. Foscarnet trisodium hexahydrate is an antiherpesvirus agent used in cytomegalovirus retinitis .
    Foscarnet trisodium hexahydrate (Standard)
  • HY-109045A
    Teslexivir hydrochloride

    BTA074 hydrochloride; AP 611074 hydrochloride

    		 E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) hydrochloride is a potent antiviral agent. Teslexivir hydrochloride is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir hydrochloride can be used for condyloma research .
    Teslexivir hydrochloride
  • HY-123032
    Sorivudine

    BV-araU

    		 DNA/RNA Synthesis Infection
    Sorivudine (BV-araU) is an orally active synthetic pyrimidine nucleoside antimetabolite agent. Sorivudine derives its antiviral activity from selective conversion by a specific thymidine kinase present in certain DNA viruses to nucleotides, which can in turn interfere with viral DNA synthesis .
    Sorivudine
  • HY-104077R
    Remdesivir (Standard)

    GS-5734 (Standard)

    		 Reference Standards DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (Standard) (GS-5734 (Standard)) is a nucleoside analogue with effective antiviral activity. Remdesivir (Standard) can inhibit the synthesis of viral DNA or RNA. Remdesivir (Standard) can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir (Standard)
  • HY-106055
    Murabutide

    		HIV Inflammation/Immunology
    Murabutide is a safe synthetic immunomodulator. Murabutide can reduce CD4 and CCR5 receptor expression and secrete high levels of beta-chemokines. Murabutide enhances nonspecific resistance against viral infections. Murabutide did not affect virus entry, reverse transcriptase activity or early proviral DNA formation in the cytoplasm of infected cells .
    Murabutide
  • HY-148781
    HBV-IN-30

    		HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-17422B
    Acyclovir monophosphate

    		DNA/RNA Synthesis HSV Antibiotic Infection Cancer
    Acyclovir monophosphate is a potent anti-herpes simplex virus (HSV) agent. Acyclovir monophosphate blocks DNA synthesis through the inhibition of the viral DNA polymerase and terminates the chain elongation of the viral DNA. Acyclovir monophosphate shows antitumor activity .
    Acyclovir monophosphate
  • HY-170547
    DNA polymerase-IN-6

    		DNA/RNA Synthesis HSV EBV CMV Infection
    DNA polymerase-IN-6 is an antiviral agent and a DNA polymerase inhibitor. DNA polymerase-IN-6 inhibits the replication of HCMV, HSV-1, HSV-2 and EBV. DNA polymerase-IN-6 exhibits low cytotoxicity in mammalian cells. DNA polymerase-IN-6 can be used in research related to viral infections .
    DNA polymerase-IN-6
  • HY-19296
    BDCRB

    2-Bromo-5,6-dichloro-1-β-D-ribofuranosyl benzimidazole

    		 CMV Infection
    BDCRB is a selective Human cytomegalovirus (HCMV) inhibitor through blocking the maturational cleavage of high-molecular-weight DNA. BDCRB shows a mean IC50 of 0.03 μM for viral yield at 72 h postinfection .
    BDCRB

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: