Delivery of temperature sensitive items including proteins and kits will be paused on 6/19 for the Juneteenth holiday. For urgent orders please contact customer service.
Bepranemab is a humanized IgG4 monoclonal antibody that binds to the central region of tau protein. Bepranemab inhibits the seeding, aggregation of pathological tau protein and the spread of tau pathology to distal brain regions. Bepranemab is applicable to research related to Alzheimer's disease .
QC-01-175 is a heterobifunctional molecule, which degrades aberrant tau. QC-01-175 reduces the levels of A152T and P301L mutant tau protein and protects neurons from tau-mediated toxicity and improve cell survival (Pink: ligand for target protein Aberrant tau ligand 1 (HY-W453397); Black: linker NH2-PEG3 (HY-W007545); Blue: ligand for E3 ligase Pomalidomide (HY-10984)) .
PROTAC α-Synuclein/Tau degrader 1 is a blood-brain barrier-penetrant dual PROTAC degrader of α-synuclein (α-Syn) andtau, with DC50 of 1.57 μM and 4.09 μM, respectively. PROTAC α-Synuclein/Tau degrader 1 binds to α-Syn and tau PFF, with KDs of 0.47 and 2.78 μM, respectively. PROTAC α-Synuclein/Tau degrader 1 exhibits degradation effect mediated by the ubiquitin-proteasome system (UPS). PROTAC α-Synuclein/Tau degrader 6 can be used for the study of Parkinson’s disease (PD) (Pink: α-Synuclein/Tau ligand (HY-151035); Blue: CRBN ligase ligand (HY-14658); Black: Linker (HY-128803)) .
Azure C (Monomethylthionine) acts as a tau oligomer inhibitor and Aβ42 oligomerization inhibitor. Azure C regulates hsp70 ATPase activity, thereby mediating the clearance of tau protein. Azure C reduces the levels of toxic tau oligomers by promoting the formation of non-toxic tau aggregates, rescues neuroblastoma cells from tau oligomer-induced toxicity, and binds to and inhibits Aβ42 oligomerization. Azure C is generated via continuous oxidation of methylene blue or azure B through a horseradish peroxidase-mediated reaction. Azure C can be used in research related to tauopathies, including Alzheimer's disease .
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .
CHIPOpt, a peptide, is an orthosteric CHIP TPR domain inhibitor with a Kd of ∼16 nM. CHIPOpt has anti-aggregation activity and decreases p.tau ubiquitination with little effect on unmodified tau. CHIPOpt can be used for Alzheimer’s disease research .
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .
C004019 is a BBB-penetrable and small-molecule PROTAC that targets tau. C004019 can simultaneously recruit tau and E3 ligase, and effectively clear tau proteins by promoting the ubiquitination and proteasome-dependent degradation of tau, thereby improving synaptic and cognitive functions in Alzheimer's disease (AD) mice. C004019 can be used in the research of AD and tau protein-related diseases. (Pink: Ligand for target protein (HY-138679); Black: linker (HY-140189); Blue: E3 Ligase Ligand (HY-138678))
Etalanetug (E2814) is a humanized high-affinity IgG1 antibody that targets tau protein and can cross the blood-brain barrier. Etalanetug inhibits the spread of pathological tau protein through high-affinity binding to the microtubule-binding region (MTBR). Etalanetug can be used in research related to Alzheimer's disease .
Aberrant tau ligand 1 is a tau protein ligand. Aberrant tau ligand 1 engages tau and CRBN to trigger proteasomal degradation. Aberrant tau ligand 1 can be used for synthesis PROTACs, such as QC-01–175 (HY-134850) .
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .
Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease .
Gosuranemab (BMS-986168; IPN007; BIIB092) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab can be used for the research of progressive supranuclear palsy and early Alzheimer’s disease .
SW02 is a potent activator of ATPase activity of Hsp70, with an EC50 of 150 μM. SW02 leads to accumulation of both total tau and phosphorylated tau (pTau) .
Tilavonemab (ABBV-8E12) is a humanized anti-tau monoclonal antibody that binds to amino acids 25-30 near the N-terminus of the tau protein. Tilavonemab can block the ability of human and mouse neurons to uptake tau aggregates. Tilavonemab can be used for research on Alzheimer’s disease and other tauopathies .
Florzolotau (APN1607) is a positron emission tomography (PET) ligand that can be used for the detection of Alzheimer's disease (AD) and other tau proteinopathies. Its binding sites are located in the β-sheet of paired helical filaments (PHFs) and straight filaments (SFs) of tau protein, as well as in the C-shaped cavity of SFs. In addition, APN-1607 binds to intraneuronal inclusions in Alzheimer's disease (AD), primary age-related tauopathy (PART) and posterior cortical atrophy (PCA). Florzolotau shows promise for PET imaging studies of neurological disorders, particularly tau proteinopathies .
Aβ/tau aggregation-IN-3 is a potent amyloid protein aggregation inhibitor with an IC50 of 0.85 μM by Aβ-Thioflavin T (Aβ-ThT) functional aggregation assay. Aβ/tau aggregation-IN-3 has anti-amyloid activity .
APNmAb005 is a human monoclonal antibody (mAb) targeting MAPT/Tau/PHF-tau. APNmAb005 blocks tau seeding in vitro and rescues neuronal loss in rTG4510 mice. APNmAb005 can be used in Alzheimer’s disease (AD) research .
Zagotenemab (LY3303560) is a humanized anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .
TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Tau Peptide (255-314) (Repeat 2 Domain) (human) (Tau-F protein (255-314)) is a polypeptide. Tau Peptide (255-314) (human) is the 255-314 fragment of Tau-F (also known as Tau-4, the 2N4 isoform), a major isoform of the Tau protein. Tau Peptide (255-314) (human) contains two core driving sequences for Tau aggregation, namely PHF6* (275-280, VQIINK) and PHF6 (306-311, VQIVYK), and spans the C-terminal half of repeat domain R1, the entire repeat domain R2, and the N-terminal half of repeat domain R3 within the microtubule-binding region (MTBR).
Tau-aggregation and neuroinflammation-IN-1 is a potent tau-aggregation and neuroinflammation inhibitor. Tau-aggregation and neuroinflammation-IN-1 exhibits remarkable inhibitory activities against AcPHF6 and full-length tau aggregation. Tau-aggregation and neuroinflammation-IN-1 has a low cytotoxicity and reduced NO release in LPS-stimulated BV2 cells. Tau-aggregation and neuroinflammation-IN-1 can reverse okadaic acid-induced memory impairment in rats .
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .
AEP-IN-2 is an asparagine endopeptidase (AEP) inhibitor via block AEP cleavage of APP and Tau. AEP-IN-2 has oral activity and decreases Aβ40 and Aβ42 and p-Tau levels .
TAU-IN-5 (compound 13) is a TAU protein inhibitor with an EC50 of 0.81 μM. TAU-IN-5 inhibits the formation of tau (2N4R isoform) oligomers and reduces the formation of tau dimers. TAU-IN-5 can be used in the study of Alzheimer's disease (AD) and Parkinson's disease (PD) .
TAU-IN-3 (Compound 2) is an orally active TAU inhibitor. TAU-IN-3 inhibits the expression of MAPT exon 10 DDPAC mutant gene in HeLa cells (IC50: 0.6 µM). TAU-IN-3 reduces the 4R/3R MAPT mRNA ratio in HeLa cells transfected with WT or DDPAC minigenes. TAU-IN-3 inhibits the insertion of endogenous MAPT exon 10 and the production of 4R tau protein in cells. TAU-IN-3 modulates tau splicing in htau mice and improves the associated behavioral phenotypes. TAU-IN-3 can be used to study neurodegenerative diseases .
Tau ligand-1 (Compound 75) is a ligand for aggregated tau protein that can penetrate the blood-brain barrier . In tissues from patients with Alzheimer's disease, progressive supranuclear palsy, corticobasal degeneration, and Pick's disease, Tau ligand-1 exhibits high affinity for aggregated tau protein, with equilibrium dissociation constant (KD) values ranging from 1 to 3.8 nM . Tau ligand-1 can serve as a potential positron emission tomography (PET) tracer and holds promise for application in positron emission tomography imaging studies of tau-related diseases in the central nervous system .
Tau protein aggregation-IN-1 (Compound 0c) is a Tau protein aggregation inhibitor. Tau protein aggregation-IN-1 can be used in the study of protein folding disorders such as Alzheimer's disease, dementia, Parkinson's disease, Huntington's disease and prion-based spongiform encephalopathies .
DN5355 is a small molecule compound that targets amyloid β protein (Aβ) and hyperphosphorylated tau protein. DN5355 can inhibit the aggregation of Aβ and tau protein and disaggregate the formed Aβ and tau protein fibers. DN5355 can be used in the study of Alzheimer's disease .
PDDC is a compound used to inhibit Alzheimer's disease. It is a nSMase2 inhibitor that can inhibit tau-induced nSMase2 activity and ceramide elevation, and slow the spread of tau in mouse models.
BF-170 is a selective tau fibril binding agent with an EC50 of 221 nM. It exhibits good blood-brain barrier permeability, and after intravenous injection in mice, the concentration in brain tissue reaches 9.1% ID/g within 2 minutes (with a brain clearance rate of 0.25% ID/g after 30 minutes). BF-170 can be used as a probe for tau protein pathology imaging in Alzheimer's disease (AD). It plays an important role in early-stage AD research and holds potential for imaging studies of tau-related neurodegenerative diseases .
ZJCK-6-46 (32) is a potential and orally activeDYRK1A inhibitor (IC50 = 0.68 nM) with high BBB permeability (CNS+). ZJCK-6-46 (32) reduces tau phosphorylation. ZJCK-6-46 (32) ameliorates cognitive dysfunction by obviously reducing the expression of phosphorylated tau and neuronal loss in vivo .
Aβ/tau aggregation-IN-1 is a potent Aβ1-42 β-sheets formation and tau aggregation inhibitor. The KD values of Aβ/tau aggregation-IN-1 with Aβ1-42 and tau are 160 μM and 337 μM, respectively. Aβ/tau aggregation-IN-1 can permeate the blood-brain barrier .
τ-Fluvalinate is an insecticide and in-hive miticide, with its mechanism involving interfering with nervous systems. τ-Fluvalinate binds to the open state of Varroa destructor (VdNaV1) and Apis mellifera (AmNaV1) voltage-dependent sodium channels, with EC50 values of 160 nM and 60 nM respectively. τ-Fluvalinate has higher affinity for AmNaV1, which causes sublethal toxicity to honeybees. τ-Fluvalinate can be applied for research on Varroa destructor infestation in honeybee colonies .
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's Tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein. Tau Peptide (275-305) specifically coordinates with group IIB metal ions (Zn²⁺, Cd²⁺, Hg²⁺), which can induce their conformational changes and significantly promote their pathological accumulation. Tau Peptide (275-305) can be used to study the role of heavy metals in neurodegenerative diseases .
MRL828 combines a Tau pathology-binding ligand and modified guanine moiety based on the ATTEC technology to selectively designate aggregated tau proteins for clearance via the ALP. MRL828 decreases intracellular Tau aggregates and promotes the secretion of Tau .
THK-523 has demonstrated its high affinity and selectivity for tau pathology both in vitro and in vivo. 18F-THK523 is a potent tau imaging radiotracer. 18F-THK523 is a potent in vivo tau imaging ligand for Alzheimer's disease .
ACI-3024 is an an orally active and highly selective Tau protein aggregation inhibitor. ACI-3024 decrease the β-sheet content and seeding properties of pathological Tau from different Tauopathies, leading to a significant rescue of the Tau-induced neurodegeneration and neuroinflammation in a cellular model. ACI-3024 is promising for research of neurodegenerative diseases .
Tau-aggregation-IN-1 (Compound D-519) is a tau441 protein aggregation inhibitor with an IC50 of 21 µM. Tau-aggregation-IN-1 is also a dopamine D2 and D3 receptor agonist .
Aberrant tau ligand 2 (Compound 4-12) is the ligand for tau protein and can be used as target protein ligand for synthesis of PROTAC degrader C004019 (HY-138669) .
Tau Peptide (337-368) (Repeat 4 Domain) is a 32-amino acid peptide derived from the fourth microtubule-binding repeat sequence (R4) of the tau protein. Tau Peptide (337-368) (Repeat 4 Domain) can be used in research on neurodegenerative diseases .
THK-5117, an arylquinoline derivative, displays high binding affinity to tau fibrils with a Ki of 10.5 nM. THK-5117 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5117 has the potential to act as a tau imaging PET probe .
Hydromethylthionine dihydrobromide (Leukomethylene blue dihydrobromide) is a potent inhibitor of TAU protein aggregation. Hydromethylthionine dihydrobromide reduces neurodegeneration by interacting with TAU proteins and preventing them from forming neurotoxic aggregates. Hydromethylthionine dihydrobromide can be used in the study of Alzheimer's disease and other TAU related disorders .
TTBK2 is a tau tubulin kinase. Mutations in TTBK2 cause spinocerebellar ataxia type 11, a disorder exhibiting both loss of Purkinje cells and widespread deposition of tau. TTBK2 Recombinant Human Active Protein Kinase is a recombinant TTBK2 protein that can be used to study TTBK2-related functions .
Tau-aggregation-IN-3 (compound 9) a Tau protein aggregation inhibitor (TAI). Tau-aggregation-IN-3 shows activity in cell-based aggregation inhibition experiments (EC50=4.816 μM). Tau-aggregation-IN-3 can be used in Alzheimer's disease research .
Tau-aggregation-IN-5 is a Tau-aggregation inhibitor (EC50 = 0.31 μM). Tau-aggregation-IN-5 targets P4HB covalently and activates mild ER stress. Tau-aggregation-IN-4 can be used for the study of neurodegenerative disorders such as Alzheimer’s and Pick’s diseases .
Tau-aggregation-IN-4 is a Tau-aggregation inhibitor (EC50 = 2.99 μM). Tau-aggregation-IN-4 can be used for the study of neurodegenerative disorders such as Alzheimer’s and Pick’s diseases .
Tau Protein/α-synuclein-IN-2 (Compound 14T) is a blood-brain barrier penetrating tau and α-syn inhibitor. Through its thiourea linker structure, Tau Protein/α-synuclein-IN-2 dose-dependently reduces α-syn oligomerization. In biosensor cells, Tau Protein/α-synuclein-IN-2 prevents the seeding effect of tau aggregation. In the M17D neuroblastoma model, Tau Protein/α-synuclein-IN-2 exhibits anti-inclusion effects. Additionally, Tau Protein/α-synuclein-IN-2 reduces Aβ plaque formation. Tau Protein/α-synuclein-IN-2 holds promise for Alzheimer's disease and Parkinson's disease research.
tau protein/α-synuclein-IN-1 is a dual inhibitor of tau protein and α-synuclein. tau protein/α-synuclein-IN-1 reduces α-syn inclusions development in M17D neuroblastoma cells. tau protein/α-synuclein-IN-1 can be used in study Alzheimer’s disease .
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .
tau-0N4R-IN-1 (Compound 6T) is an BBB-penetrable inhibitor of tau 0N4R oligomerization. tau-0N4R-IN-1 effectively inhibits the fibrosis of tau 0N4R, 2N3R, and 2N4R, exhibits an anti-seeding effect on tauin vitro, reduces the oligomerization of α-syn dose-dependently, and prevents formation of α-syn inclusions. tau-0N4R-IN-1 is stable in mouse microsomes and reduces Aβ plaques in brain tissues from AD patients. tau-0N4R-IN-1 has good pharmacokinetic properties in mice .
Tau Protein Phosphorylation-IN-1 is a tau protein phosphorylation inhibitor that potently protects PC12 cells against Aβ25–35-induced cytotoxicity (EC50 = 1.93 μM), and can penetrate the blood-brain barrier (BBB).Tau Protein Phosphorylation-IN-1 reverses the hyperphosphorylation of tau, significantly inhibits the expression of certain immune-related cytotoxic factors, suppresses the MAPK and NF-κB signaling pathways, and significantly inhibits the expression of RAGE and the apoptosis factors Bax/Bcl-2, both in vitro and in vivo. Tau Protein Phosphorylation-IN-1 relieves nerve damage, and improves learning and memory in an Alzheimer’s disease (AD) mouse model. Tau Protein Phosphorylation-IN-1 can be used for AD research .
2N4R Tau/α-Syn against-1 (Compound 4d) targets α-synuclein and tau protein, inhibits the fibrillation and oligomer formation of α-synuclein and tau proteins, exhibits disaggregation activity on Aβ fibers. 2N4R Tau/α-Syn against-1 can be used in research of Parkinson's disease and Alzheimer's disease .
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
Tau Peptide (274-288) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
THK-5105, an arylquinoline derivative, displays high binding affinity to tau fibrils. THK-5105 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5105 has the potential to act as a tau imaging PET probe .
LDN-193665 is a Tau kinase inhibitor with tauopathy-modifying activity. LDN-193665 inhibits Tau phosphorylation, improves tauopathy in animal models, reduces Sarkosyl-insoluble Tau, and restores memory. It may be necessary to simultaneously target multiple kinases to effectively inhibit tauopathies.
hAChE-IN-1 (Compound 24) is a potent hAChE inhibitor with an IC50 of 1.09 μM. hAChE-IN-1 inhibits tau-oligomerization with an EC50 of 2.71 μM in cellular tau FRET assay .
AADvac 1 TFA is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 TFA is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is a N-amino peptide that selectivity inhibits the fibrilization of tau protein. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is effective at blocking the cellular seeding of endogenous tau by interacting with monomeric or fibrillar forms of extracellular tau. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 can be used for the study of neurodegenerative diseases, such as Alzheimer’s disease .
TAU-IN-6 (Compound 13) is a Tau protein misfolding and aggregation inhibitor. TAU-IN-6 inhibits stress granules composed of tau and TIA1. TAU-IN-6 is applicable for Alzheimer's disease research .
Tau ligand-2 is a tau aggregate ligand with a Ki value of 0.99 nM. Radiolabeled ( 18F) Tau ligand-2 serves as a PET tracer. Tau ligand-2 is applicable to research related to Alzheimer's disease .
Aβ/tau aggregation-IN-4 (Compound D21) is an Aβ/tau aggregation inhibitor. Aβ/tau aggregation-IN-4 promotes the degradation of Aβ40/42 (Aβ40, IC50 = 2.151 μM; Aβ42, IC50 = 3.622 μM). Aβ/tau aggregation-IN-4 shows selective AChE inhibition (IC50: 5.56 μM). Aβ/tau aggregation-IN-4 inhibits MAO-A and MAO-B with IC50s of 0.59 μM and 0.09 μM, respectively. Aβ/tau aggregation-IN-4 suppresses intracellular ROS levels. Aβ/tau aggregation-IN-4 can be used in the research of Alzheimer's disease .
ADEL-Y01 is a humanized and parental murine blood-brain barrier-penetrating monoclonal antibody against tau-acK280. ADEL-Y01 specifically recognizes tau-acK280 and its surrounding residues, mediates the neutralization and phagocytosis of acetylated tau aggregates, and interferes with the activity of pathological tau protein. ADEL-Y01 prevents the progression of tauopathies, increases neuronal survival rate, reduces tau-related pathological changes, and improves memory impairment. ADEL-Y01 can be used in research related to Alzheimer's disease and tauopathies .
Gosuranemab (BMS-986168; IPN007; BIIB092) (powder) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab (powder) neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab (powder) can be used for the research of progressive supranuclear palsy and early Alzheimer’s disease .
Etalanetug (Mouse IgG2a) (7G6 Antibody) is a mouse monoclonal antibody targeting the HVPGG motif in the microtubule-binding domain of tau protein. Etalanetug (Mouse IgG2a) reduces the levels of insoluble tau protein in multiple brain regions and inhibits the seeding and spread of pathological tau protein. Etalanetug (Mouse IgG2a) is applicable to research related to Alzheimer's disease .
Armanezumab is a monoclonal antibody that targets and inhibits tau protein, and it specifically binds to the exposed N-terminal domain of pathological tau protein. Armanezumab can be used in relevant studies on Alzheimer's disease, frontotemporal dementia, and Pick's disease .
D-TLKIVWC is a tau fibril disaggregator. D-TLKIVWC has low immunogenicity and anti-degradation properties. D-TLKIVWC disrupts intermolecular hydrogen bonds of tau via a stress-release mechanism. D-TLKIVWC can be used in the research of amyloid diseases such as Alzheimer's disease .
O-GlcNAcase-IN-5 (Compound 1) is a selective O-GlcNAcase inhibitor. O-GlcNAcase-IN-5 can prevent the enzyme from removing the O-GlcNAc modification on tau protein, thus avoiding excessive phosphorylation of tau protein. O-GlcNAcase-IN-5 can be used for the research of Alzheimer's disease .
VY7523 is a monoclonal antibody and a selective inhibitor of pathological Tau. VY7523 reduces the propagation of pathogenic Tau in transgenic mouse models. VY7523 can be used in the research of Alzheimer's disease. The isotype control is Human IgG4 (S228P) kappa, Isotype Control (HY-P99003) .
D-688 is an inhibitor of Tau and Aβ. D-688 can reverse Aβ1–42-induced toxicity in SH-SH5Y cells and has significant neuroprotective properties. D-688 can improve the survival rate of Drosophila melanogaster expressing the human tau protein isoform (2N4R) .
JNJ-64326067 is an aggregated tau-binding agent with blood-brain barrier permeability, with a Ki of 2.4 nM. JNJ-64326067 selectively binds to aggregated tau protein but does not bind to aggregated β-amyloid protein, and shows no significant off-target binding to the tested receptors, ion channels, transporters, kinases or monoamine oxidases. JNJ-64326067 is applicable to the research of Alzheimer's disease .
3,3'-Diethyl-9-methylthiacarbocyanine iodide is a cyanine dye, also a tau aggregation inhibitor, with an IC50 value of 0.28 μM for tau. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can cause misfunction of the microtubule cytoskeleton. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can be used for researching Alzheimer’s disease .
(E/Z)-Florzolotau ((E/Z)-APN1607) is a mixed configuration or unspecified configuration of Florzolotau (HY-137557). Florzolotau (APN1607) is a positron emission tomography (PET) ligand that can be used for the detection of Alzheimer's disease (AD) and other tau proteinopathies. Its binding sites are located in the β-sheet of paired helical filaments (PHFs) and straight filaments (SFs) of tau protein, as well as in the C-shaped cavity of SFs. In addition, APN-1607 binds to intraneuronal inclusions in Alzheimer's disease (AD), primary age-related tauopathy (PART) and posterior cortical atrophy (PCA). Florzolotau shows promise for PET imaging studies of neurological disorders, particularly tau proteinopathies .
MAO-B-IN-45 is a dual inhibitor of ferroptosis and MAO-B. MAO-B-IN-45 shows selectivity towards MAO-B with an IC50 of 87.47 nM and selectivity exceeding 229-fold for MAO-B over MAO-A. MAO-B-IN-45 has excellent antiferroptosis activity through modulation of the iron metabolic pathway and GSH-GPX4 axis in vitro. MAO-B-IN-45 improves cognitive and behavioral impairments in 3×Tg (APP/Tau/Ps1) AD mouse and significantly reduced the levels of ferritin heavy chain 1 (FTH1), APP, and Tau phosphorylation (p-Tau) proteins in the brain.
RI-AG03 is a proteolytically stable tau aggregation inhibitor that crosses the blood-brain barrier and exhibits oral efficacy. RI-AG03 inhibits tau aggregation and promotes the formation of alternative amorphous aggregates that are non-amyloidogenic. RI-AG03 mediates cellular uptake through direct membrane penetration and macropinocytosis, and its conjugation with cell-penetrating peptide sequences (CPPs) enhances the binding of cells to liposomes. RI-AG03 suppresses aggregation-dependent neurodegenerative and behavioral phenotypes, and extends the lifespan of Drosophila models of tauopathy. RI-AG03 can be used for research on tau-related diseases such as Alzheimer's disease .
RI-AG03 acetate is a proteolytically stable tau aggregation inhibitor that crosses the blood-brain barrier and exhibits oral efficacy. RI-AG03 acetate inhibits tau aggregation and promotes the formation of alternative amorphous aggregates that are non-amyloidogenic. RI-AG03 acetate mediates cellular uptake through direct membrane penetration and macropinocytosis, and its conjugation with cell-penetrating peptide sequences (CPPs) enhances the binding of cells to liposomes. RI-AG03 acetate suppresses aggregation-dependent neurodegenerative and behavioral phenotypes, and extends the lifespan of Drosophila models of tauopathy. RI-AG03 acetate can be used for research on tau-related diseases such as Alzheimer's disease .
EPI-001, a selective inhibitor of Androgen Receptor (AR), targets transactivation unit 5 (Tau-5) of the AR. EPI-001 can inhibit transactivation of the AR amino-terminal domain (NTD), with an IC50 of ~6 μM. EPI-001 is also a selective modulator of PPARγ. EPI-001 is active against castration-resistant prostate cancer .
MPT0G413 (Compound 6) is a potent, selective, orally active and brain-penetrant HDAC6 inhibitor with an IC50 of 3.92 nM. MPT0G413 decreases not only the level of phosphorylation of tau proteins but also the aggregation of tau proteins. MPT0G413 can ameliorate the impaired learning and memory. MPT0G413 can be used for the research of neurological disease, such as Alzheimer's disease .
T808 is a selective tau protein-targeting ligand. T808 can be used to synthesize [ 18F]-T808, a highly selective tau protein positron emission tomography (PET) tracer. T808 can also be used to synthesize [ 3H]-T808, a marker for in vitro experiments. T808 can be used for the research of alzheimer’s disease .
Saikosaponin C (Standard) is the analytical standard of Saikosaponin C. This product is intended for research and analytical applications. Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
AO-365/43472821 is a selective, brain-penetrant Dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A) inhibitor (IC50 = 0.29 μM) and shows a significant inhibitory effect on (CDC-like kinase 1) CLK1 (IC50 = 0.08 μM). AO-365/43472821 could protect the human neuroblastoma cell line SH-SY5Y from Okadaic acid (HY-N6785) (OA)-induced injury. AO-365/43472821 decreased tau(pSer396)/tau and Aβ1-42 protein expression. AO-365/43472821 can be used for the study of Alzheimer's disease .
α-Synuclein inhibitor 11 (compound 1) is a selective α-synuclein (α-syn) oligomer formation inhibitor. α-Synuclein inhibitor 11 does not inhibits tau 4R (isoforms 0N4R, 2N4R) or p-tau (isoform 1N4R). α-Synuclein inhibitor 11 can be used for Parkinson's disease (PD) research .
PhosTAC7 is a heterobifunctional molecule named as a Phosphorylation Targeting Chimera (PhosTAC). PhosTAC7 can dephosphorylate the PDCD4 protein, FOXO3a protein, and tau protein by recruiting serine/threonine protein phosphatase 2A (PP2A). PhosTAC7 offers the advantage of selectively modulating the phosphorylation state of individual target proteins, making it a promising tool for research in cancer and tau protein-related neurodegenerative diseases (Alzheimer's disease) .
SB1617 is a neuroinflammation-modulating agent, and has neuroprotective effect by reducing pathogenic tau levels through microglia-mediated anti-inflammatory activity .
T807 (Standard) is the analytical standard of T807. This product is intended for research and analytical applications. T807 a novel tau positron emission tomography (PET) tracer.
Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies .
Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies .
TBL-100 is a human monoclonal antibody (mAb) targeting Tau. TBL-100 can be used in Alzheimer's disease (AD) and Progressive supranuclear palsy research .
N-Boc-trans-4-fluoro-L-proline is a non-natural amino acid substitute used to construct monoclonal antibodies that specifically target the seed conformation of tau protein .
AChE/BuChE/BACE-1-IN-1 is a blood-brain barrier-permeable multi-target inhibitor of AChE/BuChE/BACE, with IC50 values of 0.387 μM, 0.430 μM, and 0.531 μM against AChE, BuChE, and BACE-1, respectively. AChE/BuChE/BACE-1-IN-1 reduces the aggregation of β-amyloid protein (Aβ) and hyperphosphorylated tau protein (p-tau). AChE/BuChE/BACE-1-IN-1 can be used for the research of Alzheimer's disease .
HDAC6-IN-37 (compound W5) is an inhibitor of HDAC6 and has neuroprotective effects. HDAC6-IN-37 can restore the morphology of hippocampal neurons, reduce the expression of Aβ, Tau, and p-Tau proteins in the hippocampus of AD rats, and inhibit the formation of senile plaques and neurofibrillary tangles. Thus, HDAC6-IN-37 improves the Aβ/Cu 2+-induced AD model in rats, regulates oxidative stress status, and balances neurotransmitter disorders in brain tissue .
EPI-001 (Standard) is the analytical standard of EPI-001. This product is intended for research and analytical applications. EPI-001, a selective inhibitor of Androgen Receptor (AR), targets transactivation unit 5 (Tau-5) of the AR. EPI-001 can inhibit transactivation of the AR amino-terminal domain (NTD), with an IC50 of ~6 μM. EPI-001 is also a selective modulator of PPARγ. EPI-001 is active against castration-resistant prostate cancer .
AMG28 is an ATP-competitive inhibitor targeting TTBK1 and TTBK2, with IC50 values of 805 nM and 988 nM, respectively. AMG28 inhibits the phosphorylation of tau protein at the Ser422 site .
THK5351 (Standard) is the analytical standard of THK5351 (HY-101183). This product is intended for research and analytical applications. THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of tau pathology in the brain.
MG-1102 is first-in-class dual binder of monomeric tau and pre-miRNA-146a. MG-1102 shows specific inhibition of miRNA146a with IC50s of 0.21 mM and 0.36 mM specific inhibition of doublelabeled pre-miRNA146a and mono-labeled pre-miRNA146a, respectively. MG-1102 interacts with tau monomers with a Kd of 3.21 mM by surface plasmon resonance (SPR). MG-1102 is a potential multi-target-directed ligands (MTDLs) for Alzheimer’s disease (AD) .
CNS-11 is a brain-penetrant tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research .
hAChE-IN-2 is a potent hAChE inhibitor, with an IC50 of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC50 of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity .
TPSLP{pT}PPTR- 13C6, 15N4 TFA is the 13C- and 15N-labeled TPSLP{pT}PPTR TFA. TPSLP{pT}PPTR TFA is a tau protein fragment phosphorylated in the central region.
BSB is a Congo red-derived fluorescent probe. BSB binds not only to extracellular amyloid β protein, but also many intracellular lesions composed of abnormal tau and synuclein proteins. BSB acts as a prototype imaging agent for Alzheimer's disease .
Lithium salicylate (Salicylic acid lithium) is an orally active lithium salt. Lithium salicylate (Salicylic acid lithium) attenuates tau phosphorylation, mitigates associated pathologies in Alzheimer’s mice. Lithium salicylate (Salicylic acid lithium) can be used for Alzheimer’s research .
PAV-174 is a potent antiviral agent that targets a host protein. PAV-174 prevents Herpes simplex virus (HSV-1) infection in cells (IC50 of 0.02 μM in Vero cells) and human brain organoids. PAV-174 inhibits oxidized macrophage migration inhibitory factor (oxMIF)-induced tau phosphorylation in vitro and in vivo independent of infection. PAV-174 reduces HSV-1-induced tau phosphorylation via the Akt/GSK3β signaling pathway. PAV-174 can be used for Alzheimer’s disease research .
8-F-2-(Me-Pip-Me)-Tryptanthrin is a tryptanthrin derivative with blood-brain barrier penetration. 8-F-2-(Me-Pip-Me)-Tryptanthrin protects neurons from Aβ-induced apoptosis, inhibits Aβ-induced Tau protein hyperphosphorylation and neuronal synaptic damage, and improves learning and memory abilities in Alzheimer's disease mice. 8-F-2-(Me-Pip-Me)-Tryptanthrin can be used for the research of nervous system diseases, including diseases related to abnormal Tau protein phosphorylation and abnormal PSD-95 function .
δ-Secretase inhibitor 11 (compound 11) is an orally active, potent, BBB-penetrated, non-toxic, selective and specific δ-secretase inhibitor, with an IC50 of 0.7 μM. δ-Secretase inhibitor 11 interacts with both the active site and allosteric site of δ-secretase. δ-Secretase inhibitor 11 attenuates tau and APP (amyloid precursor protein) cleavage. δ-Secretase inhibitor 11 ameliorates synaptic dysfunction and cognitive impairments in tau P301S and 5XFAD transgenic mouse models. δ-Secretase inhibitor 11 can be used for Alzheimer's disease research .
JG-23 is a 4-chloro modified analog with ability to promote t-tau degradation. JG-23 exhibits good metabolic stability with a long T1/2 value (36 min) in mouse liver microsome assays .
NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide ( 41GCWMLY 46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin .
Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
IU1-47 is a potent and specific USP14 inhibitor with an IC50 of 0.6 μM. IU1-47 inhibits IsoT/USP5 with an IC50 of 20 μM. IU1-47 induces tau elimination in cultured neurons .
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (Ki of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .
IDT is a safe and effective TNFα and innate immune system modulator. IDT significantly reduced paired helical filament tau and fibrillar amyloid accumulation and increased the infiltrating neutrophil population while reducing TNFα expression in this population. IDT can be used in Alzheimer's disease research .
Phenchlobenpyrrone is a highly selective neuronal calcium antagonist that crosses the blood-brain barrier. Phenchlobenpyrrone mildly inhibits AChE activity. Phenchlobenpyrrone inhibits Aβ aggregation and promotes the clearance of Aβ oligomers. Phenchlobenpyrrone reduces abnormal phosphorylation of Tau protein. Phenchlobenpyrrone may be used in research on Alzheimer's disease .
BChE-IN-39 (Compound 7c) is a selective inhibitor for butyrylcholinesterase (BChE) with an IC50 of 0.08 μM (IC50=3.98 μM for AChE). BChE-IN-39 downregulates the GSK-3β expression, inhibits the hyperphosphorylation of tau protein .
SK-129 is a blood-brain barrier-permeable inhibitor of α-synuclein (αS) oligomers with a Kd of 221 nM. SK-129 preferentially binds to neurotoxic αS oligomers over physiological αS monomers, inhibits αS aggregation, blocks the interaction and co-aggregation of αS with tau protein, and prevents the maturation of αS-tau condensates into amyloid aggregates. SK-129 reduces ROS production, rescues dopaminergic neuron degeneration, improves motor function, restores endogenous dopamine synthesis, increases the number of Tyrosine Hydroxylase-positive neurons, prevents brain histopathological changes, alleviates neuroinflammation, and improves survival rates in relevant models. SK-129 can be used in research related to Parkinson's disease (PD) and Lewy body dementia (LBD) .
Quercetagitrin (Standard) is the analytical standard of Quercetagitrin. This product is intended for research and analytical applications. Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
GSK-3β inhibitor 24 (Compound 41) is a potent GSK-3β inhibitor with an IC50 of 0.22 nM. GSK-3β inhibitor 24 increases GSK-3β phosphorylation at Ser9 site dose-dependently. GSK-3β inhibitor 24 inhibits the hyperphosphorylation of tau protein by decreasing the p-tau-Ser396 abundance. GSK-3β inhibitor 24 up-regulates β-catenin and neurogenesis-related markers (GAP43 and MAP-2). GSK-3β inhibitor 24 demonstrates remarkable anti-Alzheimer's disease (AD) effects .
MAO-B-IN-31 (Compound 30) is an effective and selective inhibitor of monoamine oxidase B (monoamine oxidase B). The IC50 value is 41 nM. MAO-B-IN-31 also inhibits α-syn and tau aggregation. MAO-B-IN-31 has neuroprotective activity .
PNT001 is a human IgG1 monoclonal antibody (mAb) targeting cis-pT231 Tau. PNT001 can be used in Neurodegenerative disorders and Traumatic brain injuries research. Recommended isotype control: Human IgG1 kappa, Isotype Control (HY-P99001) .
CDK18 is a neuronal kinase that phosphorylates TAU protein when overexpressed in human brain. CDK18 shares a conserved PCTAIRE amino acid sequence in the helical α-C region of the kinase N-lobe. CDK18/CycY Recombinant Human Active Protein Kinase is an ortholog of CDK18 .
Dyrk1A-IN-11 (compound 166) is a potent dual-specificity tyrosine phosphorylation- regulated 1A (DYRK1A) inhibitor with an EC50 value of 0.0021 µM. Dyrk1A-IN-11 inhibits the Phospho-Tau (Thr212) with an EC50 value of 0.0361 µM .
Cu(II)GTSM, a cell-permeable Cu-complex, significantly inhibits GSK3β. Cu(II)GTSM inhibits Amyloid-β oligomers (AβOs) and decreases tau phosphorylation. Cu(II)GTSM also decreases the abundance of Amyloid-β trimers. Cu(II)GTSM is a potential anticancer and antimicrobial agent .
TTBK1/2-IN-2 (compound 9) is a potent Tau tubulin kinase 1 (TTBK1) and TTBK2 inhibitor with IC50s of 384 nM and 175 nM, respectively. TTBK1/2-IN-2 shows a significant ciliogenesis phenotype in human induced pluripotent stem cells (iPSCs) .
O-GlcNAcase-IN-4 (compound T-110) is a O-GlcNAcase inhibitor with an IC50 of 11.59 nM. O-GlcNAcase-IN-4 modulates the activity of O-GlcNAcase. O-GlcNAcase-IN-4 is applicable to the research of neurodegenerative diseases and disorders, Alzheimer's disease, and tau-mediated neurodegenerative diseases or disorders .
Dyrk1A-IN-9 (Compound L9) is a moderately active DYRK1A inhibitor (IC50: 1.67 μM). L9 shows neuroprotective activity by regulating the expression of Aβ and phosphorylation of Tau protein. Dyrk1A-IN-9 can be used for research of Alzheimer's disease .
Lu AF87908 is an IgG1 monoclonal antibody targeting the p-Ser396/404 epitope of tau protein, which mainly binds to the pSer396 region. Lu AF87908 can be used in the research of Alzheimer's disease. The recommended isotype control is human IgG1 kappa (HY-P99001) .
RA-PR058 is an orally active Ramalin derivative with blood-brain barrier permeability, exhibiting multi-target regulatory effects and favorable pharmacokinetic properties. RA-PR058 demonstrates potential as a multi-target modulator for Alzheimer's disease by reducing the expression of BACE1, tau protein hyperphosphorylation, and anxiety-like behaviors .
GSK-3β inhibitor 21 (compound 44) is an ATP-competitive GSK-3β inhibitor (IC50=6.06 μM) with anti-amyloid aggregation and tau phosphorylation inhibitory activities. GSK-3β inhibitor 21 can be used in the study of Alzheimer's disease .
GSK-3β inhibitor 16 (compound 7c) is a GSK-3β inhibitor with the IC50 of 4.68 nM. GSK-3β inhibitor 16 decreases Tau hyperphosphorylated aggregate and alleviates cognitive impairments in the Scopolamin (HY-N0296)-induced model in mice .
Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease .
AChE-IN-10 (Compound 24r) is a potent inhibitor of AChE (IC50 = 2.4 nM). AChE-IN-10 potently inhibits AChE, reduces tau phosphorylation at S396 residue, provides neuroprotection by rescuing neuronal morphology and increasing cell viability. AChE-IN-10 is also found to reduce amyloid aggregation in the presence of AChE .
CSH-4044 can be isolated from fermented wheat germ extract. CSH-4044 is a unique benzothiazole compound. CSH-4044 can inhibit PIM3-driven BAD phosphorylation in pancreatic cancer cell lines as well as reducing DYRK1A-induced Tau phosphorylation in neuronal cells .
PT-65 is a GSK3α and GSK3β PROTAC degrader with DC50 values of 28.3 nM and 34.2 nM, respectively. PT-65 inhibits excessive tau phosphorylation mediated by GSK3β, Aβ and Okadaic acid (HY-N6785). PT-65 is applicable for the research of Alzheimer's disease .
4-Hydroxyisophthalic acid activates antioxidant enzymes (such as catalase CAT and superoxide dismutase SOD), scavenges free radicals, and exhibits antioxidant property. 4-Hydroxyisophthalic acid activates AChE and BChE, enhances neuronal function and improves Tau-induced neurobehavioral defects. 4-Hydroxyisophthalic acid improves the cognitive defects, and ameliorates circadian rhythm disorders of fruit flies .
TTBK1/2-IN-3 (Compound 10) is a potent inhibitor of tau tubulin kinase 1 (TTBK1) and TTBK2, with IC50 values of 579 nM and 258 nM, respectively. TTBK1/2-IN-3 inhibits the phosphorylation of TDP-43. TTBK1/2-IN-3 reduces the expression of primary cilia on the surface of iPSCs .
GT-02216 can bind to GCase allosterically and enhance its activity. GT-02216 enhances the activity of GCase in primary human fibroblasts dose-dependently reduces the accumulation of its substrate, hexosylsphingosine (HexCer). GT-02216 reduces the Tau accumulation in mutant GBA1 fibroblasts. GT-02216 can be used for the study of Parkinson’s disease .
Simufilam hydrochloride (PTI-125 hydrochloride) is an orally active FLNA modulator. Simufilam hydrochloride restores NMDAR signaling and Arc expression. Simufilam hydrochloride inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam hydrochloride can be used for research of Alzheimer's disease .
Simufilam (PTI-125) is an orally active FLNA modulator. Simufilam restores NMDAR signaling and Arc expression. Simufilam inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation.
Simufilam can be used for research of Alzheimer's disease .
trans-Sobrerol (NRM-331) is a potent mucofluidifying agent. trans-Sobrerol demonstrates an anti-amnesic effect by enhancing hippocampal cholinergic signaling, alongside exhibiting anti-tau and anti-Aβ synthesis properties. trans-Sobrerol mitigates memory impairment induced by Scopolamine (HY-N0296). trans-Sobrerol can be used in the research of Alzheimer's disease .
Simufilam dihydrochloride (PTI-125 dihydrochloride) is an orally active FLNA modulator. Simufilam dihydrochloride restores NMDAR signaling and Arc expression. Simufilam dihydrochloride inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam dihydrochloride can be used for research of Alzheimer's disease .
Nimbin is an orally active intermediate limonoid found in Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin is promising for research of neurodegenerative diseases and viral infections .
Nav1.1 activator 1 (compound 4), a highly potent Nav1.1 activator with BBB penetration, increases decay time constant τ of Nav1.1 currents at 0.03 μM along with significant selectivity against Nav1.2, Nav1.5, and Nav1.6 .
hBChE-IN-1 (compound 4), a quinolizidinyl derivative, is a potent hBChE inhibitor (IC50=7 nM) and highly selective over hAChE. hBChE-IN-1 shows inhibitory activity against tau and Aβ40 protein aggregation, with IC50 values of 20 and 4.3 μM, respectively. hBChE-IN-1 can be used for Alzheimer's disease research .
BuChE-IN-5 (compound 25b) is a potent BuChE inhibitor with an IC50 value of 1.94 μM. BuChE-IN-5 efficiently inhibits aggregation Aβ and tau protein in Escherichia coli. BuChE-IN-5 also has free radical scavenging capacity and antioxidant activity. BuChE-IN-5 can be used for researching Alzheimer’s disease .
SZM679 is a potent, orally active and selective RIPK1 inhibitor with Kd values of 8.6 nM and >5000 nM for RIPK1 and RIPK3, respectively. SZM679 reverses the tumor necrosis factor-induced systemic inflammatory response. SZM679 decreases the Tau hyperphosphorylation, neuroinflammation, and the RIPK1 phosphorylation level in the hippocampus and cortex. SZM679 can be used in research of Alzheimer's disease (AD) .
GSK3β-IN-3 is an ATP-competitive GSK-3β inhibitor (IC50 = 0.90 μM). GSK3β-IN-3 can reduce the phosphorylation level of tau protein in the BR5706 strain and reduce the deposition of Aβ aggregates in the CL2006 strain, and can be used to research Alzheimer's disease (AD) .
Lithium orotate is an orally active lithium supplement with reduced binding that can bypass amyloid sequestration in AD mice models. Lithium orotate can prevent Aβ plaque deposition and phospho-tau accumulation and reverse AD pathology, neuroinflammatory changes and memory loss in AD mice models and ageing wild-type mice. Lithium orotate can be used for the research of alcoholism and Alzheimer’s disease .
(R,S,S)-VH032 is Ligand for E3 Ligase used in the synthesis of PROTACs. VH032 is a VHL ligand and VHL/HIF-1α interaction inhibitor that recruits von Hippel-Lindau (VHL) proteins. (R,S,S)-VH032 synthesizes the tau-targeting small molecule PROTAC C004019 (HY-138669) .
F-SLOH is a brain-penerant and orally active TFEB activator and amyloid-β inhibitor with an IC50 of 3.4 μM against amyloid-β. F-SLOH promotes nuclear translocation of TFEB, driving autophagy and lysosomal biogenesis. F-SLOH reduces amyloid-β oligomers and Tau aggregates via autophagy lysosomal degradation pathway. F-SLOH can be used for the research of Alzheimer’s disease .
OX-201 is an orally active, blood-brain barrier-permeable OX2R agonist with an EC50 of 8.0 nM. OX-201 activates OX2R to induce wakefulness and neuronal activation. OX-201 promotes the release of neuron activity-dependent tau protein from neurons into the interstitial fluid of hippocampal tissues. OX-201 is applicable to research related to Alzheimer's disease and tauopathies .
hAChE-IN-6 (compound 51) is a brain penetrant AChE inhibitor with an IC50 of 0.16 μM. hAChE-IN-6 also inhibits hBuChE and GSK3β with IC50 values of 0.69 μM and 0.26 μM, respectively. hAChE-IN-6 inhibits tau protein and Aβ1-42 self-aggregation, and can be used for Alzheimer's disease (AD) research .
Surfen is a potent heparan sulfate antagonist. Surfen inhibits FGF2 binding and signal transduction. Surfen binds to glycosaminoglycans and reduces tau hyperphosphorylation. Surfen inhibits the activity of recombinant uronyl 2-O-sulfotransferase with an IC50 of approximately 2 μM. Surfen inhibits HSV-1 viral infection. Surfen inhibits neural differentiation, delays remyelination, and alleviates EAE .
Sabeluzole (Standard) is the analytical standard of Sabeluzole. This product is intended for research and analytical applications. Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease .
Surfen dihydrochloride is a potent heparan sulfate antagonist. Surfen inhibits FGF2 binding and signal transduction. Surfen binds to glycosaminoglycans and reduces tau hyperphosphorylation. Surfen dihydrochloride inhibits the activity of recombinant uronyl 2-O-sulfotransferase with an IC50 of approximately 2 μM. Surfen dihydrochloride inhibits HSV-1 viral infection. Surfen dihydrochloride inhibits neural differentiation, delays remyelination, and alleviates EAE .
TTBK1-IN-2 (compound 29) is a potent Tau-Tubulin kinase (TTBK1) inhibitor with IC50s of 0.24 and 4.22 µM, respectively. TTBK1-IN-2 reveals good brain penetration in vivo and is able to reduce TDP-43 phosphorylation not only in cell cultures but also in the spinal cord of transgenic TDP-43 mice .
SCR1693 is a selective, reversible, orally active and noncompetitive inhibitor of AChE (IC50 = 0.68 μM) as well as a calcium channel blocker. SCR1693 reduces tau phosphorylation levels, and inhibits the generation and release of Aβ. SCR1693 restores insulin signaling and improves cognitive deficits. SCR1693 can be used for the study of Alzheimer's disease, especially which complicated with type 2 diabetes mellitus .
Aha1/Hsp90-IN-1 (Compound 17) is an Aha1/Hsp90 complex inhibitor. Aha1/Hsp90-IN-1 disrupts Aha1/Hsp90 interactions with an IC50 of 3.32 μM. Aha1/Hsp90-IN-1 inhibits tau aggregation .
SGK1-IN-7 is a blood-brain barrier-permeable SGK1 inhibitor with an IC50 of 0.72 μM. SGK1-IN-7 reduces the phosphorylation level of TAU protein at the Ser396 and Ser214 epitopes. SGK1-IN-7 antagonizes the toxicity induced by Okadaic acid (HY-N6785). SGK1-IN-7 can be used in the research of Alzheimer's disease .
CM-414 is a brain-penetrant phosphodiesterase 5 (PDE5) and HDAC inhibitor with IC50s of 60 nM, 91 nM, 310 nM, 322 nM and 490 nM for PDE5, HDAC6, HDAC1, HDAC3 and HDAC2, respectively. CM-414 diminishes brain Aβ and tau phosphorylation (pTau) level in Tg2576 mice. CM-414 can be used for the study of Alzheimer's disease (AD) .
PD 118717 is a selective dopamine (DA) D-2 autoreceptor agonist. PD 118717 has significant affinity for 5-HT1A but not 5-HT1B and 5-HT2 receptors. PD 118717 is active in antagonizing the tau-Butyrolactone-induced accumulation of dopa in rat striatum and mesolimbic regions. PD 118717 exhibits an antipsychotic-like profile .
(-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD) .
REM127 is an orally active, blood-brain barrier-penetrant septin 6/7 molecular glue degrader. REM127 binds to SEPT6 with high affinity and promotes the assembly of SEPT2/6/7 cortical filaments, thereby normalizing cytoplasmic calcium levels, cerebrospinal fluid hyperphosphorylated tau protein levels, synaptic function and cognitive function. REM127 can be used in research related to Alzheimer's disease .
Egalognastat (ASN90) is a selective, brain-penetrant and orally active O-GlcNAcase (OGA) enzyme inhibitor with an IC50 value of 10.2 nM. Egalognastat increases O-GlcNAcylation of intracellular proteins like tau and α-synuclein, preventing their aggregation and toxicity. Egalognastat does not inhibit hexosaminidase (Hex). Egalognastat can be used for the research of neurodegenerative diseases, such as tauopathies and α-synucleinopathies (e.g., Alzheimer’s disease and Parkinson’s disease) .
TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies . TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Apostatin-1 (Apt-1) is a potent TRADD inhibitor. Apostatin-1 can bind with TRADD-N (KD=2.17 μM), disrupting its binding to both TRADD-C and TRAF2. Apostatin-1 modulates the ubiquitination of RIPK1 and beclin 1. Apostatin-1 blocks apoptosis and restores cellular homeostasis by activating autophagy in cells with accumulated mutant tau, α-synuclein, or huntingtin .
Annonacin is an acetylgenin that is toxic by inhibiting the pathway of the mitochondrial complex. Annonacin increases tau phosphorylation in R406W +/+ mice. Annonacin acts as an inhibitor of the sodium/potassium and sarcoplasmic reticulum (SERCA) ATPase pumps. Annonacin has significant killing effect on ovarian cancer cell, cervical cancer cell, breast cancer cell, bladder cancer cell and skin cancer cell. Annonacin induces apoptosis through Bax and Caspase-3-related pathways .
GSK-3β inhibitor 27 (Compound 1c) is a reversible and competitive GSK-3β inhibitor with an IC50 value of 2.2 μM. GSK-3β inhibitor 27 inhibits tau hyperphosphorylation, reduces Aβ protein aggregation and possesses metal chelation and neuroprotective potential. GSK-3β inhibitor 27 is promising for research of neurodegenerative diseases (such as Alzheimer’s disease) .
AF710B is an orally effective allosteric agonist for the M1 muscarinic receptor and σ1 receptor. AF710B activates the downstream phosphorylated ERK1/2 and phosphorylated CREB signaling pathways. AF710B simultaneously improves cognitive function and alleviates the core pathological features of Alzheimer's disease, including Aβ deposition, excessive Tau phosphorylation and neuroinflammation. AF710B is applicable to the research of Alzheimer's disease .
CLR01 sodium is a blood-brain barrier-permeable anti-aggregation agent. CLR01 sodium inhibits the de novo aggregation of Amyloid-β 40/42, α-synuclein, IAPP, tau protein and SOD1. CLR01 sodium reduces amyloid plaque burden in the cortex of triple-transgenic mice and improves the memory and motor abilities of these mice. CLR01 sodium can be used in research related to Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis (ALS) .
ACI-19278 is a TDP-43 PET tracer with an average Kd of 25 nM. ACI-19278 only binds to pathological TDP-43 aggregates and does not cross-react with Aβ, Tau, etc. [ 18F]ACI-19278 successfully visualized the TDP-43 pathology in the human brain through positron emission computed tomography. ACI-19278 can be used for in vivo diagnosis of TDP-43 protein lesions .
PD146176 (Standard) is the analytical standard of PD146176. This product is intended for research and analytical applications. PD146176 (NSC168807), a 15-Lipoxygenase (15-LO) inhibitor, inhibits rabbit reticulocyte 15-LO (Ki=197 nM, IC50=0.54 μM). PD146176 reverses cognitive impairment, brain amyloidosis, and tau pathology by stimulating autophagy in aged triple transgenic mice .
BRD1172 (ML320) is a selectivity GSK3β inhibitor with an IC50 of 24 nM for GSK3β over CDK5. BRD1172 significantly inhibits GSK3β-mediated Tau phosphorylation in SH-SY5Y cells, and relieves negative regulation by GSK3β on β-catenin degradation and TCF/LEF promoter activities. BRD1172 can be used for Alzheimer’s disease, cardiac hypertrophy and cancers research .
ARN25699 is a kinase inhibitor with an IC50 of 5.5 nM against GSK-3β, 2.2 nM against FYN-α, and 242.3 nM against DYRK1A, and it exhibits oral bioavailability. ARN25699 reduces hyperphosphorylation of tau protein and promotes microtubule bundle formation. ARN25699 has a broader kinome inhibitory profile and targets kinases associated with the pathogenic mechanisms linked to Alzheimer's disease. ARN25699 can be used in the research of Alzheimer's disease and related tauopathies .
hAChE/hBuChE/GSK-3β-IN-1 (Compound 6c) is a BBB-penetrable and multi-target anti-Alzheimer's disease compound. hAChE/hBuChE/GSK-3β-IN-1 is the inhibitors of hAChE (IC50: 28.88 nM), hBuChE (IC50: 131.90 nM) and GSK-3β (IC50: 51.42 nM). hAChE/hBuChE/GSK-3β-IN-1 is the tau and Aβ protein aggregation inhibitors .
Hepta-histidine is an inhibitor of Ku70-Huntingtin protein interaction. Hepta-histidine can reverse the morphological abnormalities of primary neurons differentiatied from hiPSCs. Hepta-histidine prolongs the lifespan in severe Huntington’s disease R6/2 mouse model. Hepta-histidine ameliorates DNA damage in vitro. Hepta-histidine can be used to study anti-aggregation agent against Tau-associated neurodegenerative diseases such as Alzheimer’s disease and Huntington’s disease .
DYRK2-IN-2 hydrochloride is a selective DYRK2 inhibitor with an IC50 of 40.3 nM. DYRK2-IN-2 hydrochloride shows weaker inhibitory activity against DYRK1A (IC50 = 1842 nM), DYRK1B (IC50 = 1335 nM), DYRK4 (IC50 = 1931 nM), DYRK3 (IC50 = 112 nM) and CLK (IC50 = 540-6496 nM). DYRK2-IN-2 hydrochloride inhibits the phosphorylation of Thr212 in Tau protein. DYRK2-IN-2 hydrochloride is applicable for neuronal research .
GSK-3 inhibitor 4 is an orally active and brain-penetrant inhibitor of GSK-3, CDK2, and CDK5, with IC50 values of 0.56 nM (GSK-3β), 0.45 nM (GSK-3α), 0.47 μM, and 0.68 μM, respectively. GSK-3 inhibitor 4 effectively reduces the phosphorylation level of Tau protein. GSK-3 inhibitor 4 can be used in Alzheimer's disease (AD) studies .
KU-177 is a potent inhibitor of Hsp90 ATPase homologue 1 (Aha1), ablates Aha1-driven enhancement of Hsp90-dependent tau aggregation. KU-177 also disrupts Aha1/Hsp90 interactions (IC50=4.08 μM) without inhibition of Hsp90’s ATPase activity. KU-177 can be used for tauopathies research .
MAO-B-IN-50 (Compound C20) is a selective MAO-B inhibitor with an IC50 value of 0.06 μM. MAO-B-IN-50 shows good inhibitory effects on the aggregation of Aβ40/42 and Tau proteins, with overall IC50 values around 1 μM. MAO-B-IN-50 exhibits potent and selective AChE inhibition (IC50 = 1.78 μM). MAO-B-IN-50 can be used in the research of Alzheimer's disease .
FO-4-15 is an mGluR1/CaMKIIα activator. FO-4-15 has a protective effect against H2O2 in human neuroblastoma (SH-SY5Y) cells. FO-4-15 can improve cognitive impairment in Alzheimer’s disease mice by activating the mGluR1/CaMKIIα pathway, and can reduce Aβ accumulation, hyperphosphorylated Tau, and synaptic damage .
SGK1-IN-8 (compound 55) is a SGK1 and GSK3β inhibitor, with an IC50 of 0.11 μM against human SGK1 and an IC50 of 3.39 μM against human GSK3β. SGK1-IN-8 inhibits the catalytic activities of SGK1 and GSK3β, and reduces the phosphorylation level of TAU protein at the Ser214 site. SGK1-IN-8 is available for the research of Alzheimer's disease .
Omigapil maleate (CGP3466B), an orally active GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease. Omigapil maleate is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD). Omigapil maleate is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups .
Omigapil (CGP3466B free base), an orally active GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil has the potential for the research of Alzheimer's disease. Omigapil is a apoptosis inhibitor. Omigapil can be used for the research of congenital muscular dystrophy (CMD). Omigapil is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups .
AChE/BChE-IN-29 is an AChE/BChE inhibitor. AChE/BChE-IN-29 exhibits balanced dual cholinesterase inhibitory activity with IC50 values of 2.1 μM for Electrophorus electricus AChE (eeAChE) and 6.3 μM for equine serum butyrylcholinesterase (eqBChE). AChE/BChE-IN-29 effectively inhibits amyloid-β (Aβ42) aggregation and tau protein aggregation in E. coli cell models. AChE/BChE-IN-29 can be used for the study of Alzheimer’s disease (AD) .
Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research .
MPT0G211 mesylate is a potent, orally active and selective HDAC6 inhibitor (IC50=0.291 nM). MPT0G211 mesylate displays >1000-fold selective for HDAC6 over other HDAC isoforms. MPT0G211 mesylate can penetrate the blood-brain barrier. MPT0G211 mesylate ameliorates tau phosphorylation and cognitive deficits in an Alzheimer’s disease model. MPT0G211 mesylate has anti-metastatic and neuroprotective effects. Anticancer activities .
ONC-841 is a blood-brain barrier-permeable, humanized monoclonal antibody targeting SIGLEC10. As an immune checkpoint inhibitor, ONC-841 restores the functions of immune effector cells such as T cells and enhances anti-tumor immune responses by blocking inhibitory signals mediated by SIGLEC10. ONC-841 restores the phagocytic and migratory activities of microglia, and promotes the phagocytosis of Amyloid-β and Tau protein aggregates by microglia. ONC-841 is applicable to research related to solid tumors and Alzheimer's disease .
BChE/HDAC6-IN-2 (compound 29a) is a dual inhibitor of BChE and HDAC6 with IC50s of 1.8 nM and 71.0 nM, respectively. BChE/HDAC6-IN-2 has prominently neuroprotective effects and reactive oxygen species (ROS) scavenging activity. BChE/HDAC6-IN-2 is also an effective chelator of metal ion (Fe 2+ and Cu 2+). BChE/HDAC6-IN-2 inhibits phosphorylation of tau, and exhibits moderate immunomodulatory effect.
MPT0G211 is a potent, orally active and selective HDAC6 inhibitor (IC50=0.291 nM). MPT0G211 displays >1000-fold selective for HDAC6 over other HDAC isoforms. MPT0G211 can penetrate the blood-brain barrier. MPT0G211 ameliorates tau phosphorylation and cognitive deficits in an Alzheimer’s disease model. MPT0G211 has anti-metastatic and neuroprotective effects. Anticancer activities .
Anti-Mouse/Human PrP/prion protein Antibody (TW1) is a mouse-derived IgG2a type antibody inhibitor, targeting to mouse/human PrP/prion protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) binds to both PrPc (cellular prion protein) and PrPSc (Scrapie Prion Protein) and blocks the interaction of prion protein with tau protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) can be used for the researches of Alzheimer’s disease (AD) .
PROTAC GSK3 degrader-1 is a potent, blood-brain barrier-permeable GSK3PROTAC degrader, with a DC50 of 1.4 nM against GSK3β. PROTAC GSK3 degrader-1 exerts equally potent degradation activity against both GSK3α and GSK3β. It inhibits the phosphorylation of CRMP2, PRKAA1 and Tau, and stabilizes β-catenin. PROTAC GSK3 degrader-1 can be used in the research of Alzheimer's disease and Parkinson's disease .
JNK3 inhibitor-9 (Compound 24a) is a potent, selective and BBB-permeable JNK3 inhibitor with an IC50 value of 12 nM. JNK3 inhibitor-9 also potently inhibits GSK3α/β (IC50s: 14 and 35 nM, respectively) involved in Tau phosphorylation. JNK3 inhibitor-9 reduces c-Jun and APP phosphorylation. JNK3 inhibitor-9 protects neurons from Aβ1-42 toxicity .
VEN-02XX is an orally active and brain-permeable NLRP3 inhibitor. VEN-02XX inhibits the release of IL-1β and IL-18 (IC50 0.3 and 0.28 μM, respectively). VEN-02XX restores memory and cognition, inhibits microgliosis, and reduces neuroinflammation and tau pathology in the 5XFAD/Rubicon KO mouse model. VEN-02XX may be used in the study of Alzheimer's disease (AD) .
GSK3β-IN-2 (Compound S01) is the inhibitor for GSK3β with an IC50 of 0.35 nM. GSK3β-IN-2 activates Wnt/β-catenin signaling pathway, promotes neurogenesis and neurite growth. GSK3β-IN-2 inhibits Aβ-induced tau hyperphosphorylation at Ser396, reduces the formation of neurofibrillary tangles. GSK3β-IN-2 ameliorates Alzheimer's Disease in zebrafish model .
Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene Blue is a photosensitizer and redox agent. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
7BIO (7-Bromoindirubin-3-Oxime) is the derivate of indirubin. 7BIO (7-Bromoindirubin-3-Oxime) has inhibitory effects against cyclin-dependent kinase-5 (CDK5) and glycogen synthase kinase-3β (GSK3β). 7BIO (7-Bromoindirubin-3-Oxime) inhibits Aβ oligomer-induced neuroinflammation, synaptic impairments, tau hyper-phosphorylation, activation of astrocytes and microglia, and attenuates Aβ oligomer-induced cognitive impairments in mice [1].
(R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies . (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Rolofylline (KW-3902) is a potent, selective adenosine A1 receptor antagonist that is under development for the treatment of patients with acute congestive heart failure and renal impairment.
Rolofylline is metabolized primarily to the pharmacologically active M1-trans and M1-cis metabolites by cytochrome P450 (CYP450) .
Rolofylline is alleviating the presynaptic dysfunction and restores neuronal activity as well as dendritic spine levels in vitro, is an interesting candidate to combat the hypometabolism and neuronal dysfunction associated with Tau-induced neurodegenerative diseases .
BRI-50460 is an inhibitor of cytosolic calcium-dependent phospholipase A2 (cPLA2) that has the ability to penetrate the blood-brain barrier, with an IC50 of 0.88 nM. BRI-50460 exerts the activities of regulating neuroinflammation and restoring lipid homeostasis by inhibiting cPLA2, regulating the downstream inflammatory lipid signaling pathway, and alleviating the effects of amyloid β42 oligomers on the activation of cPLA2, the hyperphosphorylation of tau protein, and the reduction of synapses and dendrites. BRI-50460 can be applied to the research in the fields of Alzheimer's disease and other neurodegenerative diseases .
GSK-3β inhibitor 13 (compound 47) is an orally active and potent GSK-3β inhibitor with blood-brain permeability. GSK-3β inhibitor 13 inhibits GSK-3β and GSK-3α with IC50s of 0.73 nM and 0.35 nM, respectively. GSK-3β inhibitor 13 significantly decreases the phosphorylation of tau (IC50=58 nM), which leads the formation of the neurofibrillary tangles associated with Alzheimer's disease .
DYRK2-IN-2 (Compound C17) is a selective inhibitor of DYRK2, with its IC50 value being 40.3 nM. The inhibitory activity of DYRK2-IN-2 on DYRK1A (IC50 = 1842 nM), DYRK1B (IC50 = 1335 nM), DYRK4 (IC50 = 1931 nM), DYRK3 (IC50 = 112 nM), and CLKs (IC50 = 540-6496 NM) is relatively low. DYRK2-IN-2 inhibits the phosphorylation of Tau protein at Thr212 and shows moderate cytotoxicity in HT22 cells. DYRK2-IN-2 can be used in cancer research .
Okadaic acid, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid induces tau phosphorylation .
O-GlcNAcase-IN-2 (compound 81) is an orally effective, blood-brain barrier-permeable OGA inhibitor (IC50=4.93 nM). O-GlcNAcase-IN-2 can increase the O-GlcNAcylation level of proteins and phosphorylation of tau (p-Ser199, p-Thr205 and p-Ser396) in the OA-damaged SH-SY5Y cell model. O-GlcNAcase-IN-2 can also improve cognitive impairment in APP/PS1 mice and has potential anti-Alzheimer's disease (AD) effects .
GSK3β-IN-4 is a selective, potent, orally active and brain-penetrant ATP-competitive GSK3β inhibitor with an IC50 of 0.37 nM. GSK3β-IN-4 shows an IC50 of 2.75 nM and SI of 7.4 for GSK3α. GSK3β-IN-4 reduces tau phosphorylation at Ser396 by inhibiting GSK3β and imoroves cognitive deficits in Alzheimer's disease models. GSK3β-IN-4 can be used for the research of Alzheimer's disease .
Okadaic acid sodium, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid (sodium) has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid sodium increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid sodium induces tau phosphorylation .
Aha1/Hsp90-IN-2 is a selective inhibitor of the Hsp90/Aha1 interaction, with its IC50 being 1.46 μM. Aha1/Hsp90-IN-2 inhibits the activation of Hsp90 ATPase activity mediated by Aha1 by specifically blocking the binding of Hsp90 to Aha1, thereby reducing tau protein aggregation. Aha1/Hsp90-IN-2 can be used for the study of neurodegenerative diseases, such as Alzheimer's disease .
Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and ω-5 polyunsaturated fatty acids. Punicic acid has anti-inflammatory and antioxidant activities and can inhibit the expression of inflammatory mediators such as tumor necrosis factor α (TNF-α). Punicic acid can also reduce the formation of β-amyloid deposits and hyperphosphorylation of tau by increasing the expression of GLUT4 protein and inhibiting the overactivation of calpain, and is used to prevent and treat neurodegenerative diseases. In addition, punicic acid also has breast cancer inhibitor properties that depend on lipid peroxidation and PKC pathways .
Methylene Blue (Standard) is the analytical standard of Methylene Blue. This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Okadaic acid ammonium salt, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid ammonium salt has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid ammonium salt increases of phosphorylation of a number of proteins by inhibiting PP, and acts as a tumor promoter. Okadaic acid ammonium salt induces tau phosphorylation .
Methylene blue (hydrate) (Standard) is the analytical standard of Methylene blue (hydrate). This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Methylene blue (purity≥70%) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue (purity≥70%) is a vasopressor and is often used as a dye in several medical procedures. Methylene blue (purity≥70%) through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue (purity≥70%) is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue (purity≥70%) is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
hAChE-IN-5 (compound 49) is a potent hAChE and hBuChE inhibitor with IC50 values of 0.17 μM and 0.17 μM, respectively. hAChE-IN-5 shows potent GSK3β inhibition with an IC50 value of 0.21 μM. hAChE-IN-5 is used as tau protein aggregation and Aβ1-42 self-aggregation inhibitor. hAChE-IN-5 can bind virtually with the PAS affecting Aβ aggregation, thus preventing Aβ-dependent neurotoxicity. hAChE-IN-5 can penetrate BBB and has the potential for multi-targeted anti-Alzheimer's agents research .
H-Trp-Tyr-OH is an orally active tryptophan-tyrosine dipeptide with blood-brain barrier permeability. H-Trp-Tyr-OH exerts physiological regulatory effects by stimulating enteroendocrine cells to secrete glucagon-like peptide GLP-1. In mouse models of tauopathies, H-Trp-Tyr-OH inhibits tau phosphorylation, reduces the level of neurofibrillary tangles, increases dopamine turnover, upregulates synapsin expression, and elevates cecal short-chain fatty acid levels, thereby improving behavioral deficits and extending lifespan. H-Trp-Tyr-OH can be used in research related to impaired glucose tolerance and tauopathies .
Multitarget AD inhibitor-1 is a selective and reversible butyrylcholinesterase (BuChE) inhibitor with IC50s of 7.22 μM and 1.55 μM for hBuChE and eqBuChE (BuChE from equine serum), respectively. Multitarget AD inhibitor-1 inhibits β-secretase (IC50hBACE-1=41.60 μM), amyloid β aggregation (IC50Aβ=3.09 μM), tau aggregation. Multitarget AD inhibitor-1, a diphenylpropylamine derivative, has the potential for multifunctional disease-modifying anti-Alzheimer’s research .
Rolofylline (Standard) is the analytical standard of Rolofylline. This product is intended for research and analytical applications. Rolofylline (KW-3902) is a potent, selective adenosine A1 receptor antagonist that is under development for the treatment of patients with acute congestive heart failure and renal impairment.
Rolofylline is metabolized primarily to the pharmacologically active M1-trans and M1-cis metabolites by cytochrome P450 (CYP450) .
Rolofylline is alleviating the presynaptic dysfunction and restores neuronal activity as well as dendritic spine levels in vitro, is an interesting candidate to combat the hypometabolism and neuronal dysfunction associated with Tau-induced neurodegenerative diseases .
Apomorphine ((-)-Apomorphine) is a potent dopamine receptor agonist. Apomorphine also inhibit MAO-A and MAO-B.Apomorphine exerts neuroprotective effect and can relax rat corpus cavernosum. Apomorphine can inhibit ROS production, DNA fragmentation and inibit JNK and ERK1/2 phosphorylation. Apomorphine can enhance degradation of intracellular Aβ40 and Aβ42, reducestauprotein levelsandinhibit MMP-9 expression. Apomorphine is a highly potent radical scavenger and iron chelator. Apomorphine can be used for the researches of dementia, parkinson's disease, alzheimer disease, breast carcinoma, and erectile dysfunction .
CS640 (Compound 19) is a chemical probe and a calmodulin-dependent kinase inhibitor. CS640 inhibits CaMK1D, CaMK1B, CaMK1A, CaMK1G, MEK5, RIPK4, mLK3 and PIP5K1, with IC50 values of 8, 3, 1, 1, 25 nM, 5.69, 2.75 and 11.2 μM, respectively. CS640 blocks Aβ-induced hyperphosphorylation of tau protein at the Thr181 site, but fails to protect primary mouse cortical neurons from Aβ-induced toxic damage. CS640 is applicable to research related to Alzheimer's disease .
Schisantherin B (Gomisin-B) is a lignan compound and one of the active components of Schisandra chinensis. Schisantherin B activates the PI3K/AKT signaling pathway, restores the activity of GSK3β, and reduces the hyperphosphorylation of tau protein in hippocampal and cerebral cortical tissues. Schisantherin B upregulates the level of GLT-1, decreases the expression of pro-inflammatory cytokines TNF-α/IL-1β/IL-6, upregulates the expression of IL-10, and inhibits cell apoptosis. Schisantherin B is applicable to the research of spinal cord injury, Alzheimer's disease and depression .
Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways .
GRK2 modulator 1 is an orally active, brain-penetrant and selective GRK2 modulator. GRK2 modulator 1 enhances the active, non-phosphorylated GRK2 and prevents mitochondrial GRK2 and TOMM6 aggregation. GRK2 modulator 1 enhances the non-amyloidogenic processing of APP and prevent PHF-tau, neurodegeneration, and neuronal loss. GRK2 modulator 1 decreases the senescence marker, UPAR, reduces the Alzheimer disease (AD)-related mortality, and prolongs survival. GRK2 modulator 1 exerts neuroprotection by inhibiting HDAC6, and counteracts age-related cardiac dysfunction. GRK2 modulator 1 can be used for research on AD .
GSK-3β/HDAC-IN-2 is a potent inhibitor of GSK-3β (IC50 = 0.04 μM), HDAC2 (IC50 = 1.05 μM, Ki = 0.070 μM) and HDAC6 (IC50 = 1.52 μM, Ki = 0.017 μM). GSK-3β/HDAC-IN-2 inhibits HDAC2 and HDAC6 activities and blocks tau hyperphosphorylation. GSK-3β/HDAC-IN-2 exerts neuroprotective effects and shows no significant toxicity. GSK-3β/HDAC-IN-2 can be used in the research of Alzheimer's disease.
AChE/MAO-B-IN-9 (Compound E12) is an orally active, selective, reversible, non-competitive AChE and MAO-B inhibitor, with an IC50 of 0.156 μM against electric eel AChE. AChE/MAO-B-IN-9 inhibits Aβ40/42 fibril formation, promotes Aβ fibril depolymerization, and inhibits Tau protein fibril formation. AChE/MAO-B-IN-9 exerts antioxidant and neuroprotective effects, and improves scopolamine (HY-N0296)-induced memory impairment in mice. AChE/MAO-B-IN-9 can be used for the research of Alzheimer's disease .
Schisanhenol (Schizanhenol), a lignan, is an orally active antioxidant. Schisanhenol reduces AChE activity, increases SIRT1 and PGC-1α expression, and decreases phosphorylated Tau (Ser 396) levels. Schisanhenol increases SOD and glutathione peroxidase activity, decreases malondialdehyde (MDA) content, and inhibits UGT2B7 activitY. Schisanhenol attenuates ox-LDL-induced apoptosis, intracellular reactive oxygen species generation, and cytotoxicity in endothelial cells. Schisanhenol inhibits LDL oxidation, brain mitochondrial and membrane peroxidative damage, and brain mitochondrial swelling and disintegration. Schisanhenol can be used for the research of Alzheimer’s disease, atherosclerosis, brain ischemia, and age-related brain deterioration .
17β-HSD10/CDK5-IN-1 is a poent dual 17β-HSD10 and CDK5 inhibitor with IC50s of 2.44 and 0.26 μM for 17β-HSD10 and CDK5, respectively. 17β-HSD10/CDK5-IN-1 reduces ROS accumulation, attenuates pathological Tau phosphorylation, reduces Aβ plaque deposition, and ameliorates cognitive deficits in Alzheimer's mice. 17β-HSD10/CDK5-IN-1 can be used for the research of Alzheimer's disease .
AChE/BChE-IN-23 (Compound 6e) is an AChE/BChE inhibitor (IC50: 0.91 μM, 1.19 μM and 1.01 μM for hAChE, eq BChE and hBChE, respectively). AChE/BChE-IN-23 has antioxidant activity and inhibits Aβ1-42 and Tau protein aggregation. AChE/BChE-IN-23 also inhibits microglial activation by reducing ROS release and mitochondrial injury. AChE/BChE-IN-23 suppresses NLRP3 inflammasome and pro-inflammatory cytokines in human microglial cells. AChE/BChE-IN-23 also reverses the Scopolamine (HY-N0296)-induced memory impairment in mice model .
W2A-28 is a daul modulator of class I HDACs and Wnt/β-catenin. W2A-28 inhibits HDAC1, 2 and 3 activities with IC50 values of 512, 675, and 217 nM, respectively. W2A-28 shows selectivity over other HDACs and Sirtuin family members. W2A-28 activates Wnt/β-catenin signaling via reduced LRP6 degradation, enhances histone acetylation, suppresses tau phosphorylation, and reduces Aβ40 and Aβ42 levels. W2A-28 can be used for the research of Alzheimer's disease .
MNP2 is a NLRP3-ASC interaction inhibitor. MNP2 selectively binds to the PYD domain of ASC (Ka=149 nM) and blocks ASC-PYM binding (Ka=58 nM), thereby inhibiting the interaction between ASC and NLRP3 and suppressing the formation of the NLRP3 inflammasome. MNP2 inhibits IL-1β release and caspase-1 maturation, and reduces the efflux of potassium and chloride ions. MNP2 prevents mitochondrial damage and reactive oxygen species production, and significantly decreases NLRP3 inflammasome formation in neurodegenerative pathologies induced by β-amyloid, Tau protein and α-synuclein. MNP2 is applicable for the research of neurodegenerative diseases .
Mouse Serum Albumin is most abundant protein in plasma, which leaks into the brain parenchyma when the blood-brain barrier (BBB) is impaired. Mouse Serum Albumin induces astrocytes to A1 phenotype to remarkably increase levels of Elovl1. Mouse Serum Albumin promotes VLSFAs secretion and causes neuronal lippoapoptosis through endoplasmic reticulum stress response pathway. MSA-activated microglia triggeres remarkable tau phosphorylation at multiple sites (Ser202/Thr205) through NLRP3 inflammasome pathway. Mouse Serum Albumin decreases the spatial learning and memory abilities in mice. Mouse Serum Albumin can be used for the study of neurodegenerative diseases like Alzheimer’s disease (AD) and frontotemporal dementia (FTD) .
Myricanol is a diarylheptanoid and a Nampt activator. Myricanol exerts anti-inflammatory effects and alleviates glucocorticoid-induced muscle atrophy by increasing Sirtuin 1 (SIRT1) and PRDX5 activities while regulating inflammatory factors. Myricanol exhibits growth inhibition and induces apoptosis in human lung adenocarcinoma A549 cells. Myricanol promotes autophagy-mediated clearance of microtubule-associated protein tau to exert neuroprotective effects. Myricanol protects cardiovascular function by inhibiting PDGFRβ and NF-κB signaling pathways. Myricanol activates mitochondrial transcription factor A (TFAM) expression to exert anti-renal fibrosis effects. Myricanol improves insulin resistance through AMPK activation .
Apomorphine ((-)-Apomorphine) (Standard) is the analytical standard of Apomorphine (HY-12723). This product is intended for research and analytical applications. Apomorphine is a potent dopamine receptor agonist. Apomorphine also inhibit MAO-A and MAO-B.Apomorphine exerts neuroprotective effect and can relax rat corpus cavernosum. Apomorphine can inhibit ROS production, DNA fragmentation and inibit JNK and ERK1/2 phosphorylation. Apomorphine can enhance degradation of intracellular Aβ40 and Aβ42, reducestauprotein levelsandinhibit MMP-9 expression. Apomorphine is a highly potent radical scavenger and iron chelator. Apomorphine can be used for the researches of dementia, parkinson's disease, alzheimer disease, breast carcinoma, and erectile dysfunction .
GSK-3β inhibitor 15 (Compound 54) is a GSK-3β inhibitor (IC50: 3.4 nM). GSK-3β inhibitor 15 inhibits Aβ1-42-induced GSK-3β and tau protein phosphorylation. GSK-3β inhibitor 15 inhibits LPS-induced iNOS expression. GSK-3β inhibitor 15 has neuroprotective effects on Aβ1-42-induced neurotoxicity. GSK-3β inhibitor 15 can be used for research of Alzheimer’s disease (AD) .
Schisantherin B (Gomisin-B) (Standard) is the analytical standard of Schisantherin B. This product is intended for research and analytical applications. Schisantherin B is a lignan compound and one of the active components of Schisandra chinensis. Schisantherin B activates the PI3K/AKT signaling pathway, restores the activity of GSK3β, and reduces the hyperphosphorylation of tau protein in hippocampal and cerebral cortical tissues. Schisantherin B upregulates the level of GLT-1, decreases the expression of pro-inflammatory cytokines TNF-α/IL-1β/IL-6, upregulates the expression of IL-10, and inhibits cell apoptosis. Schisantherin B is applicable to the research of spinal cord injury, Alzheimer's disease and depression.
Multitarget AD-IN-7 is an orally active multi-target anti-AD compound. Multitarget AD-IN-7 exhibits inhibitory activity against GSK-3β and GSK-3α (IC50 = 0.66, 0.83 nM). Multitarget AD-IN-7 upregulates the expression of p-GSK-3β-Ser9, inhibits the phosphorylation of tau-Ser396, targets Aβ1-42, chelates pathogenic metal ions, scavenges ABTS•+, upregulates the expression of β-catenin and neurogenesis biomarkers, and promotes neurite outgrowth. Multitarget AD-IN-7 improves motor ability in Alzheimer's disease zebrafish. Multitarget AD-IN-7 is applicable to research related to Alzheimer's disease .
Schisanhenol (Standard) (Schizanhenol (Standard)) is the analytical standard of Schisanhenol (HY-N0859). This product is intended for research and analytical applications. Schisanhenol, a lignan, is an orally active antioxidant. Schisanhenol reduces AChE activity, increases SIRT1 and PGC-1α expression, and decreases phosphorylated Tau (Ser 396) levels. Schisanhenol increases SOD and glutathione peroxidase activity, decreases malondialdehyde (MDA) content, and inhibits UGT2B7 activitY. Schisanhenol attenuates ox-LDL-induced apoptosis, intracellular reactive oxygen species generation, and cytotoxicity in endothelial cells. Schisanhenol inhibits LDL oxidation, brain mitochondrial and membrane peroxidative damage, and brain mitochondrial swelling and disintegration. Schisanhenol can be used for the research of Alzheimer’s disease, atherosclerosis, brain ischemia, and age-related brain deterioration.
YHV98-4 is a selective, blood-brain barrier permeable Hv1 channel inhibitor. YHV98-4 specifically inhibits Hv1 with a half-maximal inhibitory concentration of 1 µM without inhibiting other ion channels. YHV98-4 reduces the propagation of p-tau. YHV98-4 increases ATP production, and enhances microglial mitophagy. YHV98-4 attenuates inflammatory pain via inhibition of Hv1 and ROS production. YHV98-4 enhances microglia-to-neuron mitochondrial transfer, promoting the delivery of functional mitochondria to rescue neuronal damage and improve cognitive function. YHV98-4 reduces inflammation. YHV98-4 can be used in the research of Alzheimer's disease .
VP3.15 dihydrobromide is a highly potent, orally bioavailable, and CNS-penetrant PDE7-GSK3 dual inhibitor, with IC50 values of 1.59 μM and 0.88 μM against PDE7 and GSK3, respectively . VP3.15 dihydrobromide elevates intracellular cAMP levels, suppresses immune responses, enhances remyelination, limits excessive tau phosphorylation, and alleviates neuroinflammation and neuronal loss. VP3.15 dihydrobromide promotes oligodendrocyte precursor cell differentiation, improves in vivo remyelination, inhibits autoimmune encephalomyelitis, and mitigates germinal matrix-intraventricular hemorrhage-related brain injury, cerebral atrophy, ventricular enlargement, and cognitive impairment. VP3.15 dihydrobromide can be used in research related to multiple sclerosis and germinal matrix-intraventricular hemorrhage .
Fludrocortisone (9α-Fludrocortisone) is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency .
Drofenine (Cycloadiphene; Hexahydroadiphenine) hydrochloride is an brain-penetrant antispasmodic agent. Drofenine hydrochloride is a Kv2.1 channel inhibitor with human IC50 of 9.53 μM. Drofenine hydrochloride is a butyrylcholinesterase (BChE) inhibitor with Ki of 0.003 mM, and is a TRPV3 activator. Drofenine hydrochloride blocks Kv2.1-dependent potassium efflux, inhibits Kv2.1/JNK/NF-κB and IkBa/NF-kB signaling, suppresses Kv2.1 mRNA/protein expression. Drofenine suppresses oligomeric Aβ-induced microglial NLRP3 inflammasome activation and neuronal Tau hyperphosphorylation, improves cognitive impairment, promotes neurite outgrowth. Drofenine hydrochloride induces calcium influx in keratinocytes and exert cytotoxicity against keratinocytes. Drofenine hydrochloride ameliorates diabetic peripheral neuropathy -like pathology. Drofenine hydrochloride can be used for the researches of Alzheimer's disease, diabetic peripheral neuropathy and smooth muscle spasm .
Drofenine (Cycloadiphene; Hexahydroadiphenine) is an brain-penetrant antispasmodic agent. Drofenine is a Kv2.1 channel inhibitor with human IC50 of 9.53 μM. Drofenine is a butyrylcholinesterase (BChE) inhibitor with Ki of 0.003 mM, and is a TRPV3 activator. Drofenine blocks Kv2.1-dependent potassium efflux, inhibits Kv2.1/JNK/NF-κB and IkBa/NF-kB signaling, suppresses Kv2.1 mRNA/protein expression. Drofenine suppresses oligomeric Aβ-induced microglial NLRP3 inflammasome activation and neuronal Tau hyperphosphorylation, improves cognitive impairment, promotes neurite outgrowth. Drofenine induces calcium influx in keratinocytes and exert cytotoxicity against keratinocytes. Drofenine ameliorates diabetic peripheral neuropathy -like pathology. Drofenine can be used for the researches of Alzheimer's disease, diabetic peripheral neuropathy and smooth muscle spasm .
Fludrocortisone-d5 (9α-Fludrocortisone-d5) is the deuterium labeled Fludrocortisone (HY-B1203). Fludrocortisone is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency.
Fludrocortisone (Standard) (9α-Fludrocortisone (Standard)) is the analytical standard of Fludrocortisone (HY-B1203). This product is intended for research and analytical applications. Fludrocortisone is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency.
Fludrocortisone-d2 (9α-Fludrocortisone-d2) is the deuterium labeled Fludrocortisone (HY-B1203). Fludrocortisone is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency.
17β-HSD10-IN-4 is a selective brain-penetrant 17β-HSD10 inhibitor with an IC50 of 6.33 μM. 17β-HSD10-IN-4 forms key interactions with the 17β-HSD10 catalytic triad to functionally inhibit the enzyme, without altering its protein levels. 17β-HSD10-IN-4 restores mitochondrial function, reduces ROS levels, increases ATP production, and suppresses cytochrome c release. 17β-HSD10-IN-4 attenuates CDK5/p25 activation, reduces Tau hyperphosphorylation, Aβ plaque load and restores brain-derived neurotrophic factor levels. 17β-HSD10-IN-4 improves cognitive function.17β-HSD10-IN-4 can be used for the research of Alzheimer's disease .
TDI-6570 (TDI-006570) is a blood-brain barrier-permeable, orally active cGAS inhibitor with an IC50 of 1.64 μM. TDI-6570 exhibits high gastrointestinal absorption and a long brain half-life in mice, and shows no toxicity to primary neurons. By inhibiting the cGAS-STING-IFN signaling pathway, TDI-6570 reduces STING levels and the activation of TBK1, blocks double-stranded DNA-induced cGAS activation and downstream interferon-stimulated gene expression, thereby reducing tau protein spread and improving synaptic loss. TDI-6570 reverses memory deficits, increases the amplitude of long-term potentiation, enhances the MEF2C transcriptional network, restores PSD-95 and vGAT punctate structures, and significantly improves cognitive resilience. TDI-6570 can be applied to the research of Alzheimer's disease, Parkinson's disease, systemic lupus erythematosus, as well as various central nervous system and autoimmune diseases .
IU1 is a selective, reversible USP14 inhibitor with an IC50 of 4-5 μM. IU1 binds USP14’s catalytic cleft to block deubiquitinase activity. IU1 induces calpain-dependent Tau cleavage, causes ATP deficits, reduces E1~Ub thioester levels and 26S proteasome assembly. IU1 enhances 26S proteasome chymotrypsin-like activity, modulates LC3B-dependent autophagy flux, reduces cancer cell proliferation and migration, and blocks G0/G1 to S phase cell cycle transition in follicular thyroid cancer cells. IU1 activates autophagy-lysosomal and ubiquitin-proteasome pathways, triggers apoptosis, and reduces cervical cancer cell growth. IU1 enhances degradation of proteasome substrates linked to neurodegenerative disease, accelerates oxidized protein degradation, and increases oxidative stress resistance. IU1 can be used for the research of Alzheimer’s disease, follicular thyroid cancer, ischemic stroke, cervical cancer, and neurodegenerative disease .
H3R antagonist 4 (compound 11L) was a dual inhibitor of cholinesterase and histamine receptor (H3R), with corresponding IC50 of 7.04 μM (eeAChE), 9.73 μM (hAChE)(reversible) and 1.09 nM (H3R) , respectively. H3R antagonist 4 inhibited the aggregation of Aβ1-42 induced by itself and Cu 2+ (95.48% and 88.63%) , and degraded the Aβ1-42 fibrils induced by itself and Cu 2+ (80.16% and 89.30%) . H3R antagonist 4 chelate biometals such as Cu 2+, Zn 2+, Al 3+, and Fe 2+. H3R antagonist 4 significantly reduced tau protein hyperphosphorylation induced by Aβ1-42 and inhibited RSL-3-induced apoptosis and ferroptosis in PC12 cells. H3R antagonist 4 had the best blood-brain barrier permeability and intestinal absorption in hCMEC/D3 and hPepT1-MDCK cells.H3R antagonist 4 ameliorates learning and memory impairment in a mouse model of Alzheimer's disease induced by scopolamine (HY-N0296) .
Pongamol (Lanceolatin C) is an orally active flavonoid with an IC50 of 75 μM and a Ki of 58 μM against PTPase-1B, and an IC50 of 103.5 μM against intestinal α-Glycosidase. Pongamol reduces the release of IL‑1β, TNF‑α, COX‑2 and iNOS in cells, reverses the nuclear translocation of NF‑κB, and upregulates the levels of Beclin 1 and LC3 Ⅱ/LC3 Ⅰ. Pongamol promotes glucose uptake by increasing the level of GLUT4 on the surface of skeletal muscle cells. Pongamol inhibits epithelial-mesenchymal transition by suppressing the FAK/Akt-mTOR signaling pathway. Pongamol inhibits neuronal cytotoxicity, suppresses cell apoptosis and extends the lifespan of Caenorhabditis elegans by activating the MAPKs/Nrf2 signaling pathway. Pongamol exerts hypoglycemic effects in diabetic mouse models. Pongamol exhibits antibacterial activity. Pongamol alleviates oxidative stress, neuroinflammation, Aβ deposition and excessive phosphorylation of Tau Protein, and restores autophagy function in Alzheimer's disease mouse models by inhibiting the Akt/mTOR signaling pathway. Pongamol is applicable to research related to Alzheimer's disease, type 2 diabetes, non-small cell lung cancer and postprandial hyperglycemia .
COX-2/HDAC6-IN-1 (Compound 11e) is a dual COX-2 and HDAC6 inhibitor, with an IC50 of 0.12 μM against HDAC6 and an IC50 of 0.66 μM against COX-2. COX-2/HDAC6-IN-1 enhances the acetylation level of α-tubulin, regulates epigenetic gene expression, and inhibits the expression of pro-inflammatory mediators (COX-2, IL-1β, IL-6 and TNF-α). COX-2/HDAC6-IN-1 promotes Amyloid-β clearance and reduces excessive phosphorylation of Tau protein. COX-2/HDAC6-IN-1 maintains neuronal morphology by stabilizing MAP2, protects synaptic integrity by regulating synapsin, and restores the expression of memory-related genes. COX-2/HDAC6-IN-1 possesses neuroprotective activity and improves learning and memory abilities in Scopolamine (HY-N0296)-induced Alzheimer's disease mouse models. COX-2/HDAC6-IN-1 is applicable to research related to Alzheimer's disease .
GSK-3β/G9a-IN-1 (Compound T2) is an orally active, selective, blood-brain-barrier permeable, competitive G9a (substrate-competitive, IC50: 1.1 μM) and GSK-3β (ATP competitive, IC50: 0.8 μM) inhibitor. GSK-3β/G9a-IN-1 is a potent H3K9me2 inhibitor that reshapes chromatin landscape. GSK-3β/G9a-IN-1 lowers tau phosphorylation, reduces Aβ aggregation. GSK-3β/G9a-IN-1 displays inhibition toward glucocorticoid receptor, androgen receptor, and alpha-2A adrenergic receptor. GSK-3β/G9a-IN-1 also upregulates SAGA complex members such as Eny2 and Sgf29. GSK-3β/G9a-IN-1 markedly improves memory, restores social behaviors, and increases synaptic complexity in late-onset Alzheimer’s disease .
Alzheimer’s Disease (AD) is a progressive degenerative brain disease which causes mental and physical decline, gradually resulting in death. Despite the significant public health issue that it poses, only few medical treatments have been approved for Alzheimer’s Disease (AD) and these act to control symptoms rather than alter the course of the disease. Discovery of new therapeutic approaches depends on the study of pathology of AD. Recent research findings have led to greater understanding of disease neurobiology in Alzheimer's Disease (AD) and identification of unique targets for drug development. Several important mechanisms have been proposed to explain the underlying pathology of AD, such as Amyloid cascade hypothesis, Tau hypothesis and Cholinergic hypothesis, etc.
MCE offers a unique collection of 2,101 compounds with anti-Alzheimer’s Disease activities or targeting the unique targets of AD. MCE Anti-Alzheimer’s Disease Compound Library is a useful tool for exploring the mechanism of AD and discovering new drugs for AD.
Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene Blue is a photosensitizer and redox agent. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (Ki of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .
Methylene blue (purity≥70%) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue (purity≥70%) is a vasopressor and is often used as a dye in several medical procedures. Methylene blue (purity≥70%) through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue (purity≥70%) is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue (purity≥70%) is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
BSB is a Congo red-derived fluorescent probe. BSB binds not only to extracellular amyloid β protein, but also many intracellular lesions composed of abnormal tau and synuclein proteins. BSB acts as a prototype imaging agent for Alzheimer's disease .
Methylene Blue (Standard) is the analytical standard of Methylene Blue. This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Mouse Serum Albumin is most abundant protein in plasma, which leaks into the brain parenchyma when the blood-brain barrier (BBB) is impaired. Mouse Serum Albumin induces astrocytes to A1 phenotype to remarkably increase levels of Elovl1. Mouse Serum Albumin promotes VLSFAs secretion and causes neuronal lippoapoptosis through endoplasmic reticulum stress response pathway. MSA-activated microglia triggeres remarkable tau phosphorylation at multiple sites (Ser202/Thr205) through NLRP3 inflammasome pathway. Mouse Serum Albumin decreases the spatial learning and memory abilities in mice. Mouse Serum Albumin can be used for the study of neurodegenerative diseases like Alzheimer’s disease (AD) and frontotemporal dementia (FTD) .
THK5351 (Standard) is the analytical standard of THK5351 (HY-101183). This product is intended for research and analytical applications. THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of tau pathology in the brain.
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .
CHIPOpt, a peptide, is an orthosteric CHIP TPR domain inhibitor with a Kd of ∼16 nM. CHIPOpt has anti-aggregation activity and decreases p.tau ubiquitination with little effect on unmodified tau. CHIPOpt can be used for Alzheimer’s disease research .
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .
RI-AG03 acetate is a proteolytically stable tau aggregation inhibitor that crosses the blood-brain barrier and exhibits oral efficacy. RI-AG03 acetate inhibits tau aggregation and promotes the formation of alternative amorphous aggregates that are non-amyloidogenic. RI-AG03 acetate mediates cellular uptake through direct membrane penetration and macropinocytosis, and its conjugation with cell-penetrating peptide sequences (CPPs) enhances the binding of cells to liposomes. RI-AG03 acetate suppresses aggregation-dependent neurodegenerative and behavioral phenotypes, and extends the lifespan of Drosophila models of tauopathy. RI-AG03 acetate can be used for research on tau-related diseases such as Alzheimer's disease .
Tau Peptide (255-314) (Repeat 2 Domain) (human) (Tau-F protein (255-314)) is a polypeptide. Tau Peptide (255-314) (human) is the 255-314 fragment of Tau-F (also known as Tau-4, the 2N4 isoform), a major isoform of the Tau protein. Tau Peptide (255-314) (human) contains two core driving sequences for Tau aggregation, namely PHF6* (275-280, VQIINK) and PHF6 (306-311, VQIVYK), and spans the C-terminal half of repeat domain R1, the entire repeat domain R2, and the N-terminal half of repeat domain R3 within the microtubule-binding region (MTBR).
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .
RI-AG03 is a proteolytically stable tau aggregation inhibitor that crosses the blood-brain barrier and exhibits oral efficacy. RI-AG03 inhibits tau aggregation and promotes the formation of alternative amorphous aggregates that are non-amyloidogenic. RI-AG03 mediates cellular uptake through direct membrane penetration and macropinocytosis, and its conjugation with cell-penetrating peptide sequences (CPPs) enhances the binding of cells to liposomes. RI-AG03 suppresses aggregation-dependent neurodegenerative and behavioral phenotypes, and extends the lifespan of Drosophila models of tauopathy. RI-AG03 can be used for research on tau-related diseases such as Alzheimer's disease .
N-Boc-trans-4-fluoro-L-proline is a non-natural amino acid substitute used to construct monoclonal antibodies that specifically target the seed conformation of tau protein .
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's Tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein. Tau Peptide (275-305) specifically coordinates with group IIB metal ions (Zn²⁺, Cd²⁺, Hg²⁺), which can induce their conformational changes and significantly promote their pathological accumulation. Tau Peptide (275-305) can be used to study the role of heavy metals in neurodegenerative diseases .
Tau Peptide (307-321) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (301-315) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (277-291) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (512-525) amide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
(Ser(PO3H2)202,Thr(PO3H2)205)-Tau Peptide (194-213) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
AADvac 1 is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
Tau Peptide (337-368) (Repeat 4 Domain) is a 32-amino acid peptide derived from the fourth microtubule-binding repeat sequence (R4) of the tau protein. Tau Peptide (337-368) (Repeat 4 Domain) can be used in research on neurodegenerative diseases .
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
Tau Peptide (298-312) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (306-317) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (304-318) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (274-288) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (295-309) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (268-282) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
(Ser(PO3H2)396,404)-Tau Peptide (379-408) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
AADvac 1 TFA is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 TFA is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is a N-amino peptide that selectivity inhibits the fibrilization of tau protein. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is effective at blocking the cellular seeding of endogenous tau by interacting with monomeric or fibrillar forms of extracellular tau. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 can be used for the study of neurodegenerative diseases, such as Alzheimer’s disease .
H-Trp-Tyr-OH is an orally active tryptophan-tyrosine dipeptide with blood-brain barrier permeability. H-Trp-Tyr-OH exerts physiological regulatory effects by stimulating enteroendocrine cells to secrete glucagon-like peptide GLP-1. In mouse models of tauopathies, H-Trp-Tyr-OH inhibits tau phosphorylation, reduces the level of neurofibrillary tangles, increases dopamine turnover, upregulates synapsin expression, and elevates cecal short-chain fatty acid levels, thereby improving behavioral deficits and extending lifespan. H-Trp-Tyr-OH can be used in research related to impaired glucose tolerance and tauopathies .
Acetyl-Tau Peptide (244-274) (Repeat 1 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
D-TLKIVWC is a tau fibril disaggregator. D-TLKIVWC has low immunogenicity and anti-degradation properties. D-TLKIVWC disrupts intermolecular hydrogen bonds of tau via a stress-release mechanism. D-TLKIVWC can be used in the research of amyloid diseases such as Alzheimer's disease .
TPSLP{pT}PPTR- 13C6, 15N4 TFA is the 13C- and 15N-labeled TPSLP{pT}PPTR TFA. TPSLP{pT}PPTR TFA is a tau protein fragment phosphorylated in the central region.
Hepta-histidine is an inhibitor of Ku70-Huntingtin protein interaction. Hepta-histidine can reverse the morphological abnormalities of primary neurons differentiatied from hiPSCs. Hepta-histidine prolongs the lifespan in severe Huntington’s disease R6/2 mouse model. Hepta-histidine ameliorates DNA damage in vitro. Hepta-histidine can be used to study anti-aggregation agent against Tau-associated neurodegenerative diseases such as Alzheimer’s disease and Huntington’s disease .
MNP2 is a NLRP3-ASC interaction inhibitor. MNP2 selectively binds to the PYD domain of ASC (Ka=149 nM) and blocks ASC-PYM binding (Ka=58 nM), thereby inhibiting the interaction between ASC and NLRP3 and suppressing the formation of the NLRP3 inflammasome. MNP2 inhibits IL-1β release and caspase-1 maturation, and reduces the efflux of potassium and chloride ions. MNP2 prevents mitochondrial damage and reactive oxygen species production, and significantly decreases NLRP3 inflammasome formation in neurodegenerative pathologies induced by β-amyloid, Tau protein and α-synuclein. MNP2 is applicable for the research of neurodegenerative diseases .
Bepranemab is a humanized IgG4 monoclonal antibody that binds to the central region of tau protein. Bepranemab inhibits the seeding, aggregation of pathological tau protein and the spread of tau pathology to distal brain regions. Bepranemab is applicable to research related to Alzheimer's disease .
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .
Etalanetug (E2814) is a humanized high-affinity IgG1 antibody that targets tau protein and can cross the blood-brain barrier. Etalanetug inhibits the spread of pathological tau protein through high-affinity binding to the microtubule-binding region (MTBR). Etalanetug can be used in research related to Alzheimer's disease .
ONC-841 is a blood-brain barrier-permeable, humanized monoclonal antibody targeting SIGLEC10. As an immune checkpoint inhibitor, ONC-841 restores the functions of immune effector cells such as T cells and enhances anti-tumor immune responses by blocking inhibitory signals mediated by SIGLEC10. ONC-841 restores the phagocytic and migratory activities of microglia, and promotes the phagocytosis of Amyloid-β and Tau protein aggregates by microglia. ONC-841 is applicable to research related to solid tumors and Alzheimer's disease .
Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease .
Gosuranemab (BMS-986168; IPN007; BIIB092) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab can be used for the research of progressive supranuclear palsy and early Alzheimer’s disease .
Tilavonemab (ABBV-8E12) is a humanized anti-tau monoclonal antibody that binds to amino acids 25-30 near the N-terminus of the tau protein. Tilavonemab can block the ability of human and mouse neurons to uptake tau aggregates. Tilavonemab can be used for research on Alzheimer’s disease and other tauopathies .
APNmAb005 is a human monoclonal antibody (mAb) targeting MAPT/Tau/PHF-tau. APNmAb005 blocks tau seeding in vitro and rescues neuronal loss in rTG4510 mice. APNmAb005 can be used in Alzheimer’s disease (AD) research .
Zagotenemab (LY3303560) is a humanized anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .
PNT001 is a human IgG1 monoclonal antibody (mAb) targeting cis-pT231 Tau. PNT001 can be used in Neurodegenerative disorders and Traumatic brain injuries research. Recommended isotype control: Human IgG1 kappa, Isotype Control (HY-P99001) .
TBL-100 is a human monoclonal antibody (mAb) targeting Tau. TBL-100 can be used in Alzheimer's disease (AD) and Progressive supranuclear palsy research .
Anti-Mouse/Human PrP/prion protein Antibody (TW1) is a mouse-derived IgG2a type antibody inhibitor, targeting to mouse/human PrP/prion protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) binds to both PrPc (cellular prion protein) and PrPSc (Scrapie Prion Protein) and blocks the interaction of prion protein with tau protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) can be used for the researches of Alzheimer’s disease (AD) .
ADEL-Y01 is a humanized and parental murine blood-brain barrier-penetrating monoclonal antibody against tau-acK280. ADEL-Y01 specifically recognizes tau-acK280 and its surrounding residues, mediates the neutralization and phagocytosis of acetylated tau aggregates, and interferes with the activity of pathological tau protein. ADEL-Y01 prevents the progression of tauopathies, increases neuronal survival rate, reduces tau-related pathological changes, and improves memory impairment. ADEL-Y01 can be used in research related to Alzheimer's disease and tauopathies .
Gosuranemab (BMS-986168; IPN007; BIIB092) (powder) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab (powder) neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab (powder) can be used for the research of progressive supranuclear palsy and early Alzheimer’s disease .
Etalanetug (Mouse IgG2a) (7G6 Antibody) is a mouse monoclonal antibody targeting the HVPGG motif in the microtubule-binding domain of tau protein. Etalanetug (Mouse IgG2a) reduces the levels of insoluble tau protein in multiple brain regions and inhibits the seeding and spread of pathological tau protein. Etalanetug (Mouse IgG2a) is applicable to research related to Alzheimer's disease .
Armanezumab is a monoclonal antibody that targets and inhibits tau protein, and it specifically binds to the exposed N-terminal domain of pathological tau protein. Armanezumab can be used in relevant studies on Alzheimer's disease, frontotemporal dementia, and Pick's disease .
VY7523 is a monoclonal antibody and a selective inhibitor of pathological Tau. VY7523 reduces the propagation of pathogenic Tau in transgenic mouse models. VY7523 can be used in the research of Alzheimer's disease. The isotype control is Human IgG4 (S228P) kappa, Isotype Control (HY-P99003) .
Lu AF87908 is an IgG1 monoclonal antibody targeting the p-Ser396/404 epitope of tau protein, which mainly binds to the pSer396 region. Lu AF87908 can be used in the research of Alzheimer's disease. The recommended isotype control is human IgG1 kappa (HY-P99001) .
Okadaic acid, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid induces tau phosphorylation .
Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
Annonacin is an acetylgenin that is toxic by inhibiting the pathway of the mitochondrial complex. Annonacin increases tau phosphorylation in R406W +/+ mice. Annonacin acts as an inhibitor of the sodium/potassium and sarcoplasmic reticulum (SERCA) ATPase pumps. Annonacin has significant killing effect on ovarian cancer cell, cervical cancer cell, breast cancer cell, bladder cancer cell and skin cancer cell. Annonacin induces apoptosis through Bax and Caspase-3-related pathways .
Schisanhenol (Schizanhenol), a lignan, is an orally active antioxidant. Schisanhenol reduces AChE activity, increases SIRT1 and PGC-1α expression, and decreases phosphorylated Tau (Ser 396) levels. Schisanhenol increases SOD and glutathione peroxidase activity, decreases malondialdehyde (MDA) content, and inhibits UGT2B7 activitY. Schisanhenol attenuates ox-LDL-induced apoptosis, intracellular reactive oxygen species generation, and cytotoxicity in endothelial cells. Schisanhenol inhibits LDL oxidation, brain mitochondrial and membrane peroxidative damage, and brain mitochondrial swelling and disintegration. Schisanhenol can be used for the research of Alzheimer’s disease, atherosclerosis, brain ischemia, and age-related brain deterioration .
Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and ω-5 polyunsaturated fatty acids. Punicic acid has anti-inflammatory and antioxidant activities and can inhibit the expression of inflammatory mediators such as tumor necrosis factor α (TNF-α). Punicic acid can also reduce the formation of β-amyloid deposits and hyperphosphorylation of tau by increasing the expression of GLUT4 protein and inhibiting the overactivation of calpain, and is used to prevent and treat neurodegenerative diseases. In addition, punicic acid also has breast cancer inhibitor properties that depend on lipid peroxidation and PKC pathways .
Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways .
Schisantherin B (Gomisin-B) is a lignan compound and one of the active components of Schisandra chinensis. Schisantherin B activates the PI3K/AKT signaling pathway, restores the activity of GSK3β, and reduces the hyperphosphorylation of tau protein in hippocampal and cerebral cortical tissues. Schisantherin B upregulates the level of GLT-1, decreases the expression of pro-inflammatory cytokines TNF-α/IL-1β/IL-6, upregulates the expression of IL-10, and inhibits cell apoptosis. Schisantherin B is applicable to the research of spinal cord injury, Alzheimer's disease and depression .
Myricanol is a diarylheptanoid and a Nampt activator. Myricanol exerts anti-inflammatory effects and alleviates glucocorticoid-induced muscle atrophy by increasing Sirtuin 1 (SIRT1) and PRDX5 activities while regulating inflammatory factors. Myricanol exhibits growth inhibition and induces apoptosis in human lung adenocarcinoma A549 cells. Myricanol promotes autophagy-mediated clearance of microtubule-associated protein tau to exert neuroprotective effects. Myricanol protects cardiovascular function by inhibiting PDGFRβ and NF-κB signaling pathways. Myricanol activates mitochondrial transcription factor A (TFAM) expression to exert anti-renal fibrosis effects. Myricanol improves insulin resistance through AMPK activation .
(-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD) .
Pongamol (Lanceolatin C) is an orally active flavonoid with an IC50 of 75 μM and a Ki of 58 μM against PTPase-1B, and an IC50 of 103.5 μM against intestinal α-Glycosidase. Pongamol reduces the release of IL‑1β, TNF‑α, COX‑2 and iNOS in cells, reverses the nuclear translocation of NF‑κB, and upregulates the levels of Beclin 1 and LC3 Ⅱ/LC3 Ⅰ. Pongamol promotes glucose uptake by increasing the level of GLUT4 on the surface of skeletal muscle cells. Pongamol inhibits epithelial-mesenchymal transition by suppressing the FAK/Akt-mTOR signaling pathway. Pongamol inhibits neuronal cytotoxicity, suppresses cell apoptosis and extends the lifespan of Caenorhabditis elegans by activating the MAPKs/Nrf2 signaling pathway. Pongamol exerts hypoglycemic effects in diabetic mouse models. Pongamol exhibits antibacterial activity. Pongamol alleviates oxidative stress, neuroinflammation, Aβ deposition and excessive phosphorylation of Tau Protein, and restores autophagy function in Alzheimer's disease mouse models by inhibiting the Akt/mTOR signaling pathway. Pongamol is applicable to research related to Alzheimer's disease, type 2 diabetes, non-small cell lung cancer and postprandial hyperglycemia .
Nimbin is an orally active intermediate limonoid found in Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin is promising for research of neurodegenerative diseases and viral infections .
4-Hydroxyisophthalic acid activates antioxidant enzymes (such as catalase CAT and superoxide dismutase SOD), scavenges free radicals, and exhibits antioxidant property. 4-Hydroxyisophthalic acid activates AChE and BChE, enhances neuronal function and improves Tau-induced neurobehavioral defects. 4-Hydroxyisophthalic acid improves the cognitive defects, and ameliorates circadian rhythm disorders of fruit flies .
Saikosaponin C (Standard) is the analytical standard of Saikosaponin C. This product is intended for research and analytical applications. Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
Quercetagitrin (Standard) is the analytical standard of Quercetagitrin. This product is intended for research and analytical applications. Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
Schisantherin B (Gomisin-B) (Standard) is the analytical standard of Schisantherin B. This product is intended for research and analytical applications. Schisantherin B is a lignan compound and one of the active components of Schisandra chinensis. Schisantherin B activates the PI3K/AKT signaling pathway, restores the activity of GSK3β, and reduces the hyperphosphorylation of tau protein in hippocampal and cerebral cortical tissues. Schisantherin B upregulates the level of GLT-1, decreases the expression of pro-inflammatory cytokines TNF-α/IL-1β/IL-6, upregulates the expression of IL-10, and inhibits cell apoptosis. Schisantherin B is applicable to the research of spinal cord injury, Alzheimer's disease and depression.
Schisanhenol (Standard) (Schizanhenol (Standard)) is the analytical standard of Schisanhenol (HY-N0859). This product is intended for research and analytical applications. Schisanhenol, a lignan, is an orally active antioxidant. Schisanhenol reduces AChE activity, increases SIRT1 and PGC-1α expression, and decreases phosphorylated Tau (Ser 396) levels. Schisanhenol increases SOD and glutathione peroxidase activity, decreases malondialdehyde (MDA) content, and inhibits UGT2B7 activitY. Schisanhenol attenuates ox-LDL-induced apoptosis, intracellular reactive oxygen species generation, and cytotoxicity in endothelial cells. Schisanhenol inhibits LDL oxidation, brain mitochondrial and membrane peroxidative damage, and brain mitochondrial swelling and disintegration. Schisanhenol can be used for the research of Alzheimer’s disease, atherosclerosis, brain ischemia, and age-related brain deterioration.
trans-Sobrerol (NRM-331) is a potent mucofluidifying agent. trans-Sobrerol demonstrates an anti-amnesic effect by enhancing hippocampal cholinergic signaling, alongside exhibiting anti-tau and anti-Aβ synthesis properties. trans-Sobrerol mitigates memory impairment induced by Scopolamine (HY-N0296). trans-Sobrerol can be used in the research of Alzheimer's disease .
Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species.Its expression varies in the nervous system according to the maturation and type of neurons.Fetal-tau/0N3R Protein, Human (His) is the recombinant human-derived Fetal-tau/0N3R protein, expressed by E.coli , with N-6*His labeled tag.
Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived Microtubule-associated protein tau protein, expressed by P.pastoris , with N-6*His labeled tag.
Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species. Its expression varies in the nervous system according to the maturation and type of neurons. Tau/0N3R Protein, Human (His, solution) is the recombinant human-derived Tau/0N3R protein, expressed by E. coli , with N-His labeled tag.
Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (P.pastoris, His) is the recombinant rat-derived Microtubule-associated protein tau protein, expressed by P. pastoris , with N-His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-D/0N4R Protein, Human (133a.a, His) is the recombinant human-derived Tau-D/0N4R protein, expressed by E. coli , with C-6*His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-441/2N4R Pre-formed Fibrils Protein, Human is the recombinant human-derived Tau-441/2N4R Pre-formed Fibrils protein, expressed by E. coli, with tag free.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human (HEK293, His) is the recombinant human-derived Tau-F/2N4R protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (HEK293, His) is the recombinant mouse-derived PNS-Tau/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.
Tau/MAPT proteins crucially promote microtubule assembly and stability, which are critical for neuronal polarity. Structurally, its C terminus binds to axonal microtubules and its N terminus binds to neuroplasmic membrane components, suggesting its role as a connexin connecting microtubules to the plasma membrane. Tau-A/MAPT Protein, Macaca mulatta (HEK293, His) is the recombinant Rhesus Macaque-derived Tau-A/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (HEK293, His) is the recombinant rat-derived Tau-A/SC1 protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human is the recombinant human-derived Tau-F/2N4R protein, expressed by E. coli , with tag free.
Interferon tau-1 (IFNT1) serves as an important paracrine hormone that initiates maternal recognition of pregnancy. After interacting with endometrial receptors, possibly type I interferon receptors, IFNT1 blocks estrogen receptor expression and prevents estrogen-induced upregulation of oxytocin receptor expression. Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His) is the recombinant bovine-derived Interferon tau-1/IFNT1 protein, expressed by P. pastoris , with N-His labeled tag.
14-3-3 theta proteins are adapters in multiple signaling pathways that recognize phosphoserine or phosphothreonine motifs and modulate chaperone activity upon binding. It negatively regulates PDPK1 kinase activity, forms homodimers, and interacts with CDK16, phosphorylated RGS7, SSH1, phosphorylated CDKN1B, GAB2, phosphorylated PDPK1, and phosphorylated DAPK2. 14-3-3 theta Protein, Human (His) is the recombinant human-derived 14-3-3 theta protein, expressed by E. coli , with N-6His labeled tag.
14-3-3 theta proteins are adapters in multiple signaling pathways that recognize phosphoserine or phosphothreonine motifs and modulate chaperone activity upon binding. It negatively regulates PDPK1 kinase activity, forms homodimers, and interacts with CDK16, phosphorylated RGS7, SSH1, phosphorylated CDKN1B, GAB2, phosphorylated PDPK1, and phosphorylated DAPK2. 14-3-3 theta Protein, Human (GST) is the recombinant human-derived 14-3-3 theta protein, expressed by E. coli , with N-GST labeled tag.
The CK1d protein is an important serine/threonine protein kinase that complexly controls cellular processes such as Wnt signaling, DNA repair, and circadian rhythms. Its versatility is evident in phosphorylating a variety of proteins, including connexin-43/GJA1, MAP1A, p53/TP53, and YAP1. CK1d Protein, Human (sf9, GST) is the recombinant human-derived CK1d protein, expressed by sf9 insect cells , with N-GST labeled tag.
CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p25 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p25, expressed by Sf9 insect cells, with N-GST, N-His, N-Flag labeled tag.
CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p35 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p35, expressed by Sf9 insect cells, with N-His, N-GST, N-Flag labeled tag.
Fludrocortisone-d5 (9α-Fludrocortisone-d5) is the deuterium labeled Fludrocortisone (HY-B1203). Fludrocortisone is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency.
Fludrocortisone-d2 (9α-Fludrocortisone-d2) is the deuterium labeled Fludrocortisone (HY-B1203). Fludrocortisone is an orally active mineralocorticoid and glucocorticoid receptor agonist. Fludrocortisone suppresses pro-inflammatory cytokine expression, reduces CCL2, IL-6, IL-8 levels, upregulates mineralocorticoid receptor (MR) expression, induces PI3K/Akt, GSK-3β, CREB, ERK1/2, mTOR phosphorylation, blocks Tau hyperphosphorylation, prevents apoptosis, promotes survival and proliferation, enhances renal sodium and water transport, increases plasma volume and blood pressure, reduces plasma potassium and renin activity, stimulates erythropoietin expression, modulates uterine receptivity genes, and reverses PP242-induced MUC1 upregulation. Fludrocortisone can be used for the research of congenital adrenal hyperplasia, postural hypotension, and adrenal insufficiency.
TPSLP{pT}PPTR- 13C6, 15N4 TFA is the 13C- and 15N-labeled TPSLP{pT}PPTR TFA. TPSLP{pT}PPTR TFA is a tau protein fragment phosphorylated in the central region.
Phospho-Tau (Ser202/Thr205) Antibody (YA3436) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to Phospho-Tau (Ser202/Thr205).
Phospho-Tau (Ser202/Thr205) Antibody (YA3436) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to Phospho-Tau (Ser202/Thr205).
Cyclin-dependent kinase 5; Cell division protein kinase 5; Serine/threonine-protein kinase PSSALRE; tau protein kinase II catalytic subunit; TPKII catalytic subunit;
IHC-P, WB
Human, Mouse, Rat
CDK5 Antibody (YA5385) is a Mouse-derived and non-conjugated monoclonal antibody, targeting to CDK5.
Omigapil maleate (CGP3466B), an orally active GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease. Omigapil maleate is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD). Omigapil maleate is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups .
Omigapil (CGP3466B free base), an orally active GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil has the potential for the research of Alzheimer's disease. Omigapil is a apoptosis inhibitor. Omigapil can be used for the research of congenital muscular dystrophy (CMD). Omigapil is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups .
Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies .
Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies .
TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
MedchemExpress Validation 03
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
MedchemExpress Validation 04
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedChemExpress values your privacy and your trust is important to us. We use cookies to enhance your website experience. Some cookies are necessary to run the website.
Privacy and Cookie Policy
