1. Search Result
Search Result
Results for "

chronic glomerular nephropathies,anti-inflammatory

" in MedChemExpress (MCE) Product Catalog:

1687

Inhibitors & Agonists

25

Screening Libraries

15

Fluorescent Dyes

21

Biochemical Assay Reagents

81

Peptides

2

MCE Kits

79

Inhibitory Antibodies

181

Natural
Products

4

Recombinant Proteins

133

Isotope-Labeled Compounds

3

Antibodies

5

Click Chemistry

32

Oligonucleotides

1

GMP Molecules

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-B0594
    Iohexol
    5 Publications Verification

    Autophagy Mitophagy Cancer
    Iohexol is a non-ionic, water-soluble contrast agent used as a reference marker for the determination of glomerular filtration rate (GFR) at the level of renal function. Iohexol can be used for contrast in myelography, computerized tomography (cisternography, ventriculography) and MicroCT imaging .
    Iohexol
  • HY-B1472
    Deoxycorticosterone acetate
    2 Publications Verification

    11-Deoxycorticosterone acetate; DOC acetate; Cortexone acetate

    Mineralocorticoid Receptor Endogenous Metabolite Metabolic Disease
    Deoxycorticosterone acetate (DOCA) is an adrenocortin, acts as a precursor to aldosterone. Deoxycorticosterone acetate is a mineralocorticoid receptor agonist. Deoxycorticosterone acetate can cause severe renal injury, including inflammation, fibrosis, glomerular damage, and proteinuria .
    Deoxycorticosterone acetate
  • HY-B0801
    Fexofenadine
    5 Publications Verification

    MDL-16455; Terfenadine carboxylate

    Histamine Receptor Inflammation/Immunology Cancer
    Fexofenadine (MDL-16455) is an orally active and nonsedative H1 receptor antagonist. Fexofenadine can be used in allergic rhinitis and chronic idiopathic urticarial research .
    Fexofenadine
  • HY-B0504
    Creatinine
    5+ Cited Publications

    NSC13123

    Endogenous Metabolite GABA Receptor iGluR Infection Neurological Disease Metabolic Disease Cancer
    Creatinine (NSC13123) is an orally active, blood-brain barrier-permeable modulator of GABAA and NMDA receptors, with activities of antioxidation and metabolic regulation. Creatinine is generated via non-enzymatic conversion of creatine and phosphocreatine in muscle. Creatinine serum levels correlate with muscle mass, glomerular filtration rate, and extrarenal clearance, serving as an evaluation biomarker for renal function, muscle mass, and clinical outcomes, and used for perioperative renal risk assessment. In addition, Creatinine can induce specific Cryptococcus species to produce creatinine deiminase and act as their nitrogen source, while it can be secreted via renal tubules. Creatinine is widely used in research related to various diseases such as neurodegenerative diseases, psychiatric disorders, acute kidney injury, chronic kidney disease, and renal failure .
    Creatinine
  • HY-B0801A
    Fexofenadine hydrochloride
    5 Publications Verification

    MDL-16455 hydrochloride; Terfenadine carboxylate hydrochloride

    Histamine Receptor Inflammation/Immunology Cancer
    Fexofenadine (MDL-16455) hydrochloride is an orally active and nonsedative H1 receptor antagonist. Fexofenadine hydrochloride can be used in allergic rhinitis and chronic idiopathic urticarial research .
    Fexofenadine hydrochloride
  • HY-101277
    Vadadustat
    5+ Cited Publications

    PG-1016548; AKB-6548

    HIF/HIF Prolyl-Hydroxylase Cardiovascular Disease
    Vadadustat (PG-1016548) is a titratable, oral hypoxia-inducible factor prolyl hydroxylase (HIF-PH) inhibitor . Vadadustat is an erythropoiesis-stimulating agent and has the potential for anemia treatment in chronic kidney disease in vivo .
    Vadadustat
  • HY-109170

    BAY 1817080

    P2X Receptor Inflammation/Immunology
    Eliapixant (BAY 1817080) is a potent and selective antagonist of P2X3 receptor, with an IC50 of 8 nM. Eliapixant can be used for the research of refractory chronic cough .
    Eliapixant
  • HY-132265
    SCO-267
    3 Publications Verification

    Free Fatty Acid Receptor Metabolic Disease
    SCO-267 is an allosteric GPR40 full agonist. SCO-267 can be used for the research of chronic diseases including diabetes .
    SCO-267
  • HY-B0944
    Pidotimod
    2 Publications Verification

    Bacterial Inflammation/Immunology
    Pidotimod is an orally active dipeptide immunostimulant with immunomodulatory properties on the adaptive and the innate immune responses. Pidotimod increases macrophage activity and humoral immune functions. Pidotimod can be used for the research of chronic bronchitis, chronic obstructive pulmonary disease (COPD), bronchiectasis, and chronic idiopathic urticaria,et al .
    Pidotimod
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-Y1324

    Disodium hydrogen phosphate dodecahydrate; Disodium phosphate dodecahydrate

    Environmental Pollutants Biochemical Assay Reagents Endocrinology
    Phosphoric acid disodium dodecahydrate is an inorganic compound and food additive. Phosphoric acid disodium dodecahydrate promotes gel formation, improves food texture and thermal properties of materials. Phosphoric acid disodium dodecahydrate induces glomerular calcification. Phosphoric acid disodium dodecahydrate can be used in kidney disease research .
    Sodium phosphate dibasic dodecahydrate
  • HY-B0419
    Manidipine
    3 Publications Verification

    Calcium Channel Interleukin Related Cardiovascular Disease Neurological Disease Endocrinology
    Manidipine is an orally active calcium channel antagonist. Manidipine regulates the expression of cytokines (IL-1β, IL-6). Manidipine has a hypotensive effect. Manidipine can be used in the study of cardiovascular diseases (such as hypertension, myocardial ischemia-reperfusion injury, ventricular hypertrophy), kidney diseases (such as glomerular diseases), and epilepsy .
    Manidipine
  • HY-P5381
    gp91 ds-tat
    1 Publications Verification

    NADPH Oxidase Ferroptosis Reactive Oxygen Species (ROS) Glutathione Peroxidase TRP Channel Cardiovascular Disease Neurological Disease Inflammation/Immunology
    gp91 ds-tat, a biological active peptide, is a NADPH oxidase 2 (Nox2) inhibitor. gp91 ds-tat blocks NADPH oxidase-dependent superoxide production. gp91 ds-tat ameliorates high glucose-induced increase in total ROS, LPOs and iron levels. gp91 ds-tat inhibits homocysteine (Hcy)-induced activation of NLRP3 inflammasomes and restores Hcy-inhibited lysosomal TRPML1 channel activity. gp91 ds-tat improves cerebrovascular and cognitive function in APP/PS1 mice. gp91 ds-tat can be used for the study of Alzheimer’s disease (AD), glomerular inflammation and cardiovascular disease .
    gp91 ds-tat
  • HY-172279A

    Liposome Cancer
    DSPE-PEG2000-TAT is a cell-penetrating peptide-modified PEGylated phospholipid conjugate and cellular uptake enhancer. DSPE-PEG2000-TAT forms via conjugation of Cys-TAT to DSPE-PEG2000-Mal. DSPE-PEG2000-TAT enhances liposomal cellular uptake and siRNA transfection efficiency in glomerular mesangial and macrophage cells. DSPE-PEG2000-TAT can be used for drug delivery .
    DSPE-PEG2000-TAT
  • HY-128901

    F 14679 fumarate

    5-HT Receptor Neurological Disease
    F13714 fumarate, a selective 5-HT1A receptor biased agonist, shows antidepressant-like properties after a single administration in the mouse model of chronic mild stress .
    F 13714 fumarate
  • HY-15545

    CCR Inflammation/Immunology
    AZD-4818 is a potent, orally active antagonist of chemokine CCR1. AZD-4818 can be used for researching chronic obstructive pulmonary disease (COPD) .
    AZD-4818
  • HY-112597A

    REN001; HPP593

    PPAR Inflammation/Immunology
    Mavodelpar (REN001) is a selective PPARδ agonist. Mavodelpar suppresses glomerular injury and renal fibrosis. Mavodelpar can be used for the research of primary mitochondrial myopathies (PMM) and long-chain fatty acid oxidation disorders (LC-FAOD) . Mavodelpar is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    Mavodelpar
  • HY-123572

    AG1717

    Dynamin HIV Integrase Infection Metabolic Disease Inflammation/Immunology
    Bis-T-23 (AG1717), tyrphostin derivative, is an HIV-I integrase inhibitor. Bis-T-23 can promote actin-dependent dynamin oligomerization. Bis-T-23 can be used for the research of HIV and chronic kidney diseases (CKD) .
    Bis-T-23
  • HY-100657

    meta-MDL-16455; meta-Terfenadine carboxylate

    Drug Metabolite Inflammation/Immunology
    meta-Fexofenadine (meta-MDL-16455) is an impurity of Fexofenadine . Fexofenadine, a H1R antagonist, is an anti-allergic agent used in seasonal allergic rhinitis and chronic idiopathic urticarial .
    meta-Fexofenadine
  • HY-152036A

    PROTACs Bcr-Abl Cancer
    SIAIS100 TFA is a potent BCR-ABL PROTAC degrader with an DC50 value of 2.7 nM. SIAIS100 TFA can be used to research chronic myeloid leukemia (CML) .
    SIAIS100 TFA
  • HY-111144

    AZD0548; LAS100977

    Adrenergic Receptor Inflammation/Immunology
    Abediterol (LAS100977) is an inhaled long-acting β2-adrenoceptor agonist (LABA) and can be used for the research of asthma and chronic obstructive pulmonary disease (COPD) .
    Abediterol
  • HY-B0629

    Glucocorticoid Receptor Metabolic Disease Cancer
    Mometasone is an inhaled glucocorticoid. Mometasone can be used in mild asthma with a low sputum eosinophil level. Mometasone has the potential for the research of chronic hand eczema and rhinosinusitis .
    Mometasone
  • HY-B0010D
    Arformoterol tartrate
    1 Publications Verification

    (R,R)-Formoterol tartrate

    Adrenergic Receptor Inflammation/Immunology
    Arformoterol ((R,R)-Formoterol) tartrate, the (R,R)-enantiomer of Formoterol, is a long-acting β2-adrenergic receptor (β2-AR) agonist, with a Kd of 2.9 nM. Arformoterol tartrate can be used for the research of chronic obstructive pulmonary disease (COPD) .
    Arformoterol tartrate
  • HY-Y0308D

    Disodium hydrogen phosphate, meets analytical specification of Ph. Eur. BP USP FCC E339

    Biochemical Assay Reagents Endocrinology
    Sodium phosphate dibasic (Disodium hydrogen phosphate), meets analytical specification of Ph. Eur. BP USP FCC E339 is an inorganic dibasic phosphate that functions as an electrolyte supplement, a buffer carrier for injectable drugs, while also exhibiting nephrotoxicity. Sodium phosphate dibasic, meets analytical specification of Ph. Eur. BP USP FCC E339 induces extensive nephrotic syndrome-like changes, including systemic symptoms such as persistent proteinuria, lipemia, hypercholesterolemia, and anemia, and causes severe renal pathological alterations such as renal enlargement, glomerular calcification, podocyte injury, and tubulointerstitial lesions. Sodium phosphate dibasic, meets analytical specification of Ph. Eur. BP USP FCC E339 has the ability to induce phosphate-induced nephropathy and glomerular calcification, and can be widely used in studies on nephrotic syndrome and related renal pathological mechanisms .
    Sodium phosphate dibasic, meets analytical specification of Ph. Eur. BP USP FCC E339
  • HY-120441

    GK115

    Phospholipase Prostaglandin Receptor Inflammation/Immunology
    CAY10590 (GK115) is an inhibitor of secreted phospholipase A2 (sPLA2) and can be used for the research of chronic inflammatory kidney diseases .
    CAY10590
  • HY-W416250

    Drug Metabolite Cardiovascular Disease
    p-Cresol glucuronide, a metabolite of p-cresol, is a prototype protein-bound uremic toxin. p-Cresol glucuronide is associated with chronic kidney disease (CKD) .
    p-Cresol glucuronide
  • HY-141411A

    (S)-MRI-1867

    Cannabinoid Receptor NO Synthase Metabolic Disease
    Zevaquenabant ((S)-MRI-1867) is a peripherally restricted, orally bioavailable dual cannabinoid CB1 receptor and inducible NOS antagonist. Zevaquenabant ameliorates obesity-induced chronic kidney disease (CKD) .
    Zevaquenabant
  • HY-B0010A
    Arformoterol
    1 Publications Verification

    (R,R)-Formoterol

    Adrenergic Receptor Inflammation/Immunology
    Arformoterol ((R,R)-Formoterol), the (R,R)-enantiomer of Formoterol, is a long-acting β2-adrenergic receptor (β2-AR) agonist, with a Kd of 2.9 nM. Arformoterol can be used for the research of chronic obstructive pulmonary disease (COPD) .
    Arformoterol
  • HY-117411A

    KW-136 dihydrochloride

    HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection .
    Coblopasvir dihydrochloride
  • HY-10657

    Urotensin Receptor Cardiovascular Disease Others
    SB-706375 is an antagonist of the Urotensin II (UII) receptor. By blocking the Urotensin II receptor, SB-706375 reduces the kidney's response to UII and Urotensin-related peptide (URP) and significantly increases the Glomerular Filtration Rate (GFR). SB-706375 can be used in research on kidney diseases and hypertension .
    SB-706375
  • HY-B0594R

    Reference Standards Autophagy Mitophagy Cancer
    Iohexol (Standard) is the analytical standard of Iohexol. This product is intended for research and analytical applications. Iohexol is a non-ionic, water-soluble contrast agent used as a reference marker for the determination of glomerular filtration rate (GFR) at the level of renal function. Iohexol can be used for contrast in myelography, computerized tomography (cisternography, ventriculography) and MicroCT imaging .
    Iohexol (Standard)
  • HY-162008

    HSP Bcl-2 Family Cancer
    S1g-10 is a Hsp70/Bim inhibitor, and shows antitumor activity in chronic myeloid leukemia cells .
    S1g-10
  • HY-130391

    MMP Inflammation/Immunology
    MMP12-IN-3 (compound 32) is a potent MMP12 inhibitor with an IC50 value of 4.9 nM. MMP12-IN-3 has the potential for the research of chronic respiratory diseases such as emphysema .
    MMP12-IN-3
  • HY-121513

    2'-Deoxy-L-cytidine; L-dC

    HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment .
    Torcitabine
  • HY-N0117AR

    (Z)-Couroupitine B (Standard); (Z)-Indigo red (Standard); (Z)-Indigopurpurin (Standard)

    Reference Standards Apoptosis Cancer
    (Z)-Indirubin (Standard) is the analytical standard of (Z)-Indirubin (HY-N0117A). (Z)-Indirubin is an isomer of Indirubin (HY-N0117). Indirubin is a bisindole alkaloid with significant anticancer activity against chronic myeloid leukemia.
    (Z)-Indirubin (Standard)
  • HY-12733

    Dipeptidyl Peptidase Inflammation/Immunology
    AZD5248 is a dipeptidyl peptidase 1 (DPP1) inhibitor that can be used for the research of chronic obstructive lung disease .
    AZD5248
  • HY-123791

    Elastase Inflammation/Immunology
    AZD-9819 is a neutrophil elastase (HNE) inhibitor. AZD-9819 can be used to study chronic obstructive pulmonary disease .
    AZD-9819
  • HY-P11208C

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-WSTF TFA is the trifluoroacetate salt of mNLS-CPP-WSTF (HY-P11208). mNLS-CPP-WSTF is a nuclear localization signal (NLS)-cell-penetrating peptide based on the mouse WSTF sequence. mNLS-CPP-WSTF significantly inhibits the GABARAP-WSTF interaction, WSTF degradation and inflammatory gene expression. mNLS-CPP-WSTF effectively attenuates chronic inflammation, liver fibrosis and cartilage damage in metabolic-dysfunction-associated steatohepatitis (MASH) and osteoarthritis (OA) mice model. mNLS-CPP-WSTF is promising for research of chronic inflammatory diseases such as MASH and OA .
    mNLS-CPP-WSTF TFA
  • HY-19830

    Phosphodiesterase (PDE) Inflammation/Immunology
    AN3199 is a PDE4 inhibitor with an IC50 of 94.5 nM. AN3199 can be used for the research of inflammation-associated diseases such as asthma and chronic obstructive pulmonary disease (COPD) .
    AN3199
  • HY-109071

    MB-102

    Fluorescent Dye Others
    Relmapirazin (MB-102) is a fluorescent tracer agent for real-time measurement of glomerular filtration rate .
    Relmapirazin
  • HY-152036

    PROTACs Bcr-Abl Cancer
    SIAIS100 is a potent BCR-ABL PROTAC degrader with an DC50 value of 2.7 nM. SIAIS100 can be used to research chronic myeloid leukemia (CML) .
    SIAIS100
  • HY-101581

    804CB; Bucloxonic acid; Esfar

    Drug Derivative Inflammation/Immunology
    Bucloxic acid is an anti-inflammatory pyrrazole derivative. Bucloxic acid can be used for study of chronic glomerular nephropathies.
    Bucloxic acid
  • HY-P11208A

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-scramble is a negative control peptide of mNLS-CPP-WSTF. mNLS-CPP-scramble is promising for research of chronic inflammatory diseases (e.g., MASH, osteoarthritis) .
    mNLS-CPP-scramble
  • HY-175437

    Molecular Glues Src Bcr-Abl Inflammation/Immunology Cancer
    MRT-7612 (Compound 4) is a cereblon-based tyrosine kinases molecular glue degrader. MRT-7612 significantly induces HCK and LYN degradation, with week efficacy on LCK. MRT-7612 can be used for cancers like chronic myeloid leukemia, autoimmune and chronic inflammatory diseases research .
    MRT-7612
  • HY-P11208B

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-scramble (TFA) is the trifluoroacetate salt of mNLS-CPP-scramble (HY-P11208A). mNLS-CPP-scramble is a negative control peptide of mNLS-CPP-WSTF. mNLS-CPP-scramble is promising for research of chronic inflammatory diseases (e.g., MASH, osteoarthritis) .
    mNLS-CPP-scramble TFA
  • HY-P4051

    HBV Infection Inflammation/Immunology
    HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .
    HBV Seq1 aa:141-151
  • HY-144401
    DS-3801b
    1 Publications Verification

    Motilin Receptor Metabolic Disease
    DS-3801b is a potent and non-macrolide agonist of GPR38. DS-3801b is expected to be novel gastrointestinal prokinetic agents for the research of functional gastrointestinal disorders such as gastroparesis and chronic constipation .
    DS-3801b
  • HY-160431

    PPAR NF-κB COX Drug Metabolite Metabolic Disease
    8(9)-EET is one of the main metabolites produced by the metabolism of arachidonic acid (HY-109590) through the cytochrome P450 epoxide pathway. 8(9)-EET is an effective substrate for COX-1 and COX-2. 8(9)-EET activates PPARα in HEK293 cells and inhibits the activity of NF-κB induced by IL-1β in a PPARα-dependent and -independent manner. The (8S,9R)-isomer of 8(9)-EET ([(8S,9R)-EET]) causes vasoconstriction, thereby reducing renal plasma flow and glomerular filtration rate .
    8(9)-EET
  • HY-169737

    Glycosidase Amylases Metabolic Disease
    Inulobiose is a difructan disaccharide that can be isolated from Pistacia vera L.. Inulobiose inhibits α-glycosidase and α-amylase activities with IC50s of 1.87 and 40.72 mg/mL, respectively. Inulobiose can be used for the research of diabetes and glomerular filtration rate testing .
    Inulobiose
  • HY-100446

    Glutaminase Apoptosis Metabolic Disease Inflammation/Immunology
    NTU281 is a potent transglutaminase-2 inhibitor. NTU281 can reduce the increases in serum creatinine and albuminuria in diabetic rats. NTU281 can also reduce glomerular collagen I accumulation, Hic-5 and α-SMA expression, and apoptosis. NTU281 can be used for researching glomerulosclerosis caused by diabetes .
    NTU281

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: