DSP30

Cat. No.: HY-177058 Purity: 95.27%: Data Sheet
COA

SDS
Handling Instructions
FAQs
Technical Support

DSP30 is a phosphorothioate cpG-oligodeoxynucleotide and a TLR9 agonist. DSP30 can activate immune system cells, including B cells and dendritic cells, by inducing proliferation and cytokine production.DSP30 can enhance the immunosuppressive function of bone marrow-multipotent mesenchymal stromal cells (BM-MSC). DSP30 combined with interleukin 2 (IL2) is an effective mitotic stimulant in B-cell disorders. DSP30 can be used for the genetic characteristic research and analysis of chronic lymphocytic leukemia (CLL).

For research use only. We do not sell to patients.

DNA, d(P-thio)(TCGTCGCTGTCTCCGCTTCTTCTTGCC)

DSP30 Chemical Structure

Size	Stock	Quantity
1 mg	In-stock	Estimated Time of Arrival: December 31
5 mg	In-stock	Estimated Time of Arrival: December 31
10 mg	In-stock	Estimated Time of Arrival: December 31
50 mg	Get quote
100 mg	Get quote

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

View All Toll-like Receptor (TLR) Isoform Specific Products:

View All Isoforms

TLR3 TLR8 TLR9 TLR2 TLR4 TLR7 TLR1 TLR6

Biological Activity
Purity & Documentation
References
Customer Review

Description

In Vitro

DSP30 (1 μM, 5 days) enhances the immunosuppressive function of BM-MSCs by promoting their proliferation, upregulating anti-inflammatory factors such as TGF-β1, maintaining high expression of IFN-γ and IL-10 in co-cultured T cells, and increasing the level of adenosine^[1].
DSP30 (10 μg/mL, 5 days) enables CRTH2₊ allergen-stimulated T_H2 cells to produce IFN-γ^[4].
DSP30 (0.1-1 μM, 0-72 h) significantly upregulates the expression of CD25 in B-CLL cells^[5].
DSP30 (0.01-1 μM, 48-120 h) significantly enhances the killing effect of LMB-2 on B-CLL cells^[5].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

RT-PCR^[1]

Cell Line:	BM-MSC, T lymphocytes
Concentration:	1 μM
Incubation Time:	5 days
Result:	Had no impact on the expression of the inflammatory cytokine IL-6. Induced the expression of IL-1β, IL-8 and TGF-β1. Led to a significant increase in IL-8 and VCAM expression levels with LSP (HY-D1056) stimulation. Maintained the high expression of IFN-γ and IL-10 in T cells with upregulated BM-MSC.

Cell Viability Assay^[5]

Cell Line:	B-CLL cells
Concentration:	1 μM
Incubation Time:	5 days
Result:	Significantly enhanced the sensitivity of B-CLL cells to LMB-2. Enabled the originally drug-resistant B-CLL cells to reach the clinically achievable IC₅₀ level.

Appearance

Solid

Color

White to off-white

SMILES

N/A

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation

Purity: 95.27%

Select Batch:

Data Sheet (275 KB) SDS (252 KB)

COA (250 KB) RP-HPLC (159 KB) MS (81 KB)

Handling Instructions (2242 KB)

References

[1]. Sangiorgi B, et al. DSP30 enhances the immunosuppressive properties of mesenchymal stromal cells and protects their suppressive potential from lipopolysaccharide effects: A potential role of adenosine. Cytotherapy. 2016 Jul;18(7):846-59. [Content Brief]

[2]. Dun KA, et al. DSP30 and interleukin-2 as a mitotic stimulant in B-cell disorders including those with a low disease burden. Genes Chromosomes Cancer. 2018 May;57(5):260-267. [Content Brief]

[3]. Haferlach C, et al. Comprehensive genetic characterization of CLL: a study on 506 cases analysed with chromosome banding analysis, interphase FISH, IgV(H) status and immunophenotyping. Leukemia. 2007 Dec;21(12):2442-51. [Content Brief]

[4]. Annunziato F, et al. Reversal of human allergen-specific CRTH2+ T(H)2 cells by IL-12 or the PS-DSP30 oligodeoxynucleotide. J Allergy Clin Immunol. 2001 Nov;108(5):815-21. [Content Brief]

[5]. Decker T, et al. Sensitization of B-cell chronic lymphocytic leukemia cells to recombinant immunotoxin by immunostimulatory phosphorothioate oligodeoxynucleotides. Blood. 2002 Feb 15;99(4):1320-6. [Content Brief]

DSP30 Related Classifications

Inflammation/Immunology

Molarity Calculator
Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass		Concentration		Volume		Molecular Weight *
	=		×		×

The dilution calculator equation

Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final)

This equation is commonly abbreviated as: C₁V₁ = C₂V₂

Concentration _(start)	×	Volume _(start)	=	Concentration _(final)	×	Volume _(final)
	×		=		×
C1		V1		C2		V2

Help & FAQs

Do most proteins show cross-species activity?
Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

DSP30DSP 30DSP-30Toll-like Receptor (TLR)MitosisOligonucleotideBM-MSCIL2B-cell disorderImmunosuppressionInhibitorinhibitorinhibit

Your Recently Viewed Products:

Product Name

Requested Quantity *

Applicant Name *

Salutation

Email Address *

Phone Number *

Department

Organization Name *

City

State

Country or Region *

Remarks

Product Name

Lot #

Applicant Name *

Email Address *

Phone Number

Department *