Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
10005 Results for "
chemical modification
" in MedChemExpress (MCE) Product Catalog:
Products (10005)
10005 Results for "chemical modification" in MCE Product Catalog:
3
3 Cited Publications
Cat. No.: HY-RI04602A
MicroRNA Antagomir Negative Control is a chemically-modified oligonucleotide (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification), and can be used as a negative control. The sequence of MicroRNA Antagomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
3
3 Cited Publications
Cat. No.: HY-RI00449A
hsa-miR-21-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
2
2 Cited Publications
Synonyms: 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride
Target:
Research Areas:
Lipase,Candida antarctica (Immobilized) is an immobilized lipase isolated from Candida antarctica fraction B. Lipase,Candida antarctica (Immobilized) features high stability and selectivity. Lipase,Candida antarctica (Immobilized) is widely used in fields such as chemical synthesis, food oil modification, and biodiesel production .
Cat. No.: HY-P3581
CAS No.: 1801959-12-5
Target:
Research Areas:
Cat. No.: HY-140651
Purity: ≥93.0%
Target:
Research Areas:
Amine-PEG2000-thiol is a conjugate containing amino, PEG and thiol groups, used for drug delivery, material modification and chemical synthesis.
Cat. No.: HY-107783
CAS No.: 185332-92-7
Target:
Research Areas:
Sulfo-GMBS is a crosslinker widely used in chemical modification and coupling reactions of proteins and peptides. Among amine-thiol crosslinkers, Sulfo-GMBS generates the largest number of crosslinks and covers most of the crosslinks identified by AMAS and GMBS .
Cat. No.: HY-W012184
CAS No.: 59016-56-7
Cat. No.: HY-RI00144
hsa-miR-1246 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Cat. No.: HY-W686605
CAS No.: 54907-61-8
Iodoacetic anhydride is a bioactive compound with enzyme inhibitory properties. Iodoacetic anhydride can participate in protein modification and is widely used in biochemical research and compound development. Iodoacetic anhydride is also used to synthesize various bioactive molecules, showing its diversity as a chemical reagent.
Cat. No.: HY-RI00057
hsa-miR-107 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
Cat. No.: HY-140653
Target:
Research Areas:
Amine-PEG5000-thiol is a conjugate containing amino, PEG and thiol groups, used for drug delivery, material modification and chemical synthesis.
Cat. No.: HY-176960
CAS No.: 141895-16-1
Target:
Research Areas:
3-Amino-2-hydroxypropyl dihydrogen phosphate is a chemical modification complex of the DNA phosphate backbone, which can be used to study the interaction between HIV integrase (IN) and DNA .
Cat. No.: HY-W001851
CAS No.: 1631-26-1
Synonyms: N-Benzylmaleimide
Cat. No.: HY-RI00161
hsa-miR-1257 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
Cat. No.: HY-140652
Target:
Research Areas:
Amine-PEG3400-thiol is a conjugate containing amino, PEG and thiol groups, used for drug delivery, material modification and chemical synthesis.
Cat. No.: HY-W036734
CAS No.: 23868-34-0
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
