MicroRNA Antagomir Negative Control
Based on 3 publication(s) in Google Scholar
MicroRNA Antagomir Negative Control is a chemically-modified oligonucleotide (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification), and can be used as a negative control. The sequence of MicroRNA Antagomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
For research use only. We do not sell to patients.
- Purity: 99.43%
- Molecular Weight:7540.89
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Publications Citing Use of MedChemExpress (MCE) MicroRNA Antagomir Negative Control
More
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 7540.89
-
Color White to off-white
-
SMILES
[MicroRNA Antagomir Negative Control]
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
UUUGUACUACACAAAAGUACUG
-
Stem-loop ID
cel-miR-239b
-
Stem-loop Sequence
GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU
-
Species
Caenorhabditis elegans
Publications (3)
-
Journal Impact Factor
-
Most Recent
-
Cell Death Dis
2025 Jul 1;16(1):465. PMID: 40593496 -
Arch Biochem Biophys
KLF5-mediated transcriptional activation of miR-203a inhibits EMT and increases cisplatin sensitivity by targeting SNAI2 in tongue cancer. [Abstract]2026 Aug:782:110845. PMID: 42092415 -
Purity & Documentation
-
Data Sheet (239 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)