MicroRNA Mimic Negative Control
Based on 18 publication(s) in Google Scholar
MicroRNA Mimic Negative Control is a miRNA mimic of 21-nucleotides, and can be used as a negative control. The sequence of MicroRNA Mimic Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
For research use only. We do not sell to patients.
- Purity: 91.34%
- Molecular Weight:13332.58
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Publications Citing Use of MedChemExpress (MCE) MicroRNA Mimic Negative Control
More- Adv Sci (Weinh). 2025 Dec 14:e02250. [Abstract]
- Research (Wash D C). 2026 May 7:9:1248. [Abstract]
- Research (Wash D C). 2026 Mar 24.
- Int J Biol Macromol. 2025 Dec;333(Pt 2):148750. [Abstract]
- Br J Pharmacol. 2026 Mar 10. [Abstract]
- Nutrients. 2026 Feb 13;18(4):612. [Abstract]
- Int J Mol Sci. 2026 Mar 13;27(6):2646. [Abstract]
- Sci Rep. 2025 Apr 9;15(1):12182. [Abstract]
- Oncol Res. 2025 Sep 26;33(10):3023-3040. [Abstract]
- Hum Cell. 2025 Aug 27;38(5):152. [Abstract]
- Discov Oncol. 2025 May 19;16(1):817. [Abstract]
- Cytotechnology. 2026 May 11;78(3):113.
- BMC Ophthalmol. 2025 Jul 1;25(1):367. [Abstract]
- Clin Appl Thromb Hemost. 2025 Jan-Dec:31:10760296251319953. [Abstract]
- Oncol Lett. 2024 Apr 10;27(6):262. [Abstract]
- Cancer Biother Radiopharm. 2025 Jun;40(5):323-338. [Abstract]
- Tohoku J Exp Med. 2025 Jun 26. [Abstract]
- bioRxiv. 2026 May 29.
Biological Activity
1. miRNA Resuspension
1.1 Briefly centrifuge the tube to ensure that the dried miRNA is at the bottom of the tube.
1.2 Resuspend the miRNA using nuclease free water to generate 20 μM stock solution.
For 5 nmol miRNA: add 250 μL nuclease free water.
For 20 nmol miRNA: add 1000 μL nuclease free water.
1.3 Aliquot miRNAs into one or more tubes to limit the number of freeze-thaw cycles (<5).
1.4 Store at or below -20°C or -80°C in a non-frost-free freezer until use.
2. Prepare cells
2.1 Inoculate cells in advance for cell transfection. The viability and general health of cells prior to transfection significantly affect transfection result.
3. Transfection
3.1 Prepare transfection mix A and B.
For per well of a 6-well plate: A: 240 μL serum-free medium + 10 μL miRNA; B: 230 μL serum-free medium + 20 μL siRNA/miRNA Transfection Reagent (HY-K2017).
For per well of a 12-well plate: A: 95 μL serum-free medium + 5 μL miRNA; B: 90 μL serum-free medium + 10 μL siRNA/miRNA Transfection Reagent (HY-K2017).
For per well of a 24-well plate: A: 47.5 μL serum-free medium + 2.5 μL miRNA; B: 45 μL serum-free medium + 5 μL siRNA/miRNA Transfection Reagent (HY-K2017).
For per well of a 96-well plate: A: 24.5 μL serum-free medium + 0.5 μL miRNA; B: 24 μL serum-free medium + 1 μL siRNA/miRNA Transfection Reagent (HY-K2017).
Note: The recommended working concentration is 100 nM for miRNA inhibitors. miRNA function can vary greatly, depending on the miRNA, the cell line, and the chosen analysis method. To determine the concentration that provides optimal results, optimization experiments using varying mimic/inhibitor concentrations should be performed. The optimized range suggests changing the miRNA concentration in the range of 20 to 500 nM.
If other transfection reagents are used, the amount of transfection reagent needs to be adjusted according to the specific situation.
3.2 Mix A and B gently. Incubate at room temperature for 15 minutes.
3.3 Remove culture medium from cells, wash with PBS.
3.4 Add transfection mix (A+B) to cells.
For per well of a 6-well plate: add 1500 μL serum-free medium, then add 500 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 12-well plate: add 800 μL serum-free medium, then add 200 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 24-well plate: add 400 μL serum-free medium, then add 100 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 96-well plate: add 50 μL serum-free medium, then add 50 μL of the transfection mix (A+B) to the well, and mix well.
3.5 Incubate cells for 1-3 days at 37°C. Then, analyze transfected cells. The medium can be replaced with fresh serum-containing medium after 6 hours if necessary.
Note: Antibiotics can increase toxicity and should be omitted during transfection. Culture medium containing polyanions such as heparin, heparin sulfate or dextran sulfate can inhibit transfection.
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
Chemical Information
-
Appearance Solid
-
Molecular Weight 13332.58
-
Color White to off-white
-
SMILES
[MicroRNA Mimic Negative Control]
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
UUUGUACUACACAAAAGUACUG
-
Stem-loop ID
cel-miR-239b
-
Stem-loop Sequence
GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU
-
Species
Caenorhabditis elegans
Publications (18)
-
Journal Impact Factor
-
Most Recent
-
Adv Sci (Weinh)
Circular RNA PTPN4 Contributes to Blood-Brain Barrier Disruption during Early Epileptogenesis. [Abstract]2025 Dec 14:e02250. PMID: 41391036 -
Research (Wash D C)
Hypoxia-Challenged sEVs-Engineered Nanofiber Scaffolds Accelerate Diabetic Wound Healing via Reversing Cellular Dysfunction of Skin Repair Cells. [Abstract]2026 May 7:9:1248. PMID: 42109884 -
-
Int J Biol Macromol
Exosomal microRNA-20b-5p contributes to cytarabine resistance in acute myeloid leukemia via the microtubule-associated serine/threonine kinase-like-phosphatidylinositol 3-kinase-protein kinase B signaling axis. [Abstract]2025 Dec;333(Pt 2):148750. PMID: 41197693 -
Br J Pharmacol
Exosomes from macrophages intervened by Jiedu Yangxin decoction mediated endothelial-to-mesenchymal transition to improve myocardial fibrosis after myocardial infarction. [Abstract]2026 Mar 10. PMID: 41804264 -
Nutrients
Biotin Deficiency Alters the Expression Profile of Colonic microRNAs: Possible Contribution to the Alterations in Expression of Proteins Involved in the Maintenance of Colonic Physiology and Inflammation. [Abstract]2026 Feb 13;18(4):612. PMID: 41754129 -
Int J Mol Sci
LRRC8A Inhibition Overcomes Chemoresistance by Downregulating MRP3 and CYP3A4 in the 3D Spheroid Model of Human Breast Cancer Cells. [Abstract]2026 Mar 13;27(6):2646. PMID: 41898509 -
Sci Rep
MiR-556-3p mediated repression of klotho under oxidative stress promotes fibrosis of renal tubular epithelial cells. [Abstract]2025 Apr 9;15(1):12182. PMID: 40204752 -
Oncol Res
Competitive Sequestration of miR-1183 by lncRNA DDX11-AS1 Drives Gliomagenesis through E2F7 Activation. [Abstract]2025 Sep 26;33(10):3023-3040. PMID: 41050080 -
Hum Cell
FTO inhibited miR-487a-3p biosynthesis via N6-methyladenosine-dependent pathway to promote WNT5A-mediated osteogenic differentiation of adipose-derived stem cells. [Abstract]2025 Aug 27;38(5):152. PMID: 40864302 -
Discov Oncol
5,7,2',6'- Tetrahydroxyflavone affects the progression of ovarian cancer via hsa-miR-495-3p-ACTB/HSP90AA1 pathway. [Abstract]2025 May 19;16(1):817. PMID: 40389695 -
-
BMC Ophthalmol
Decreased miR-455-3p promotes diabetic retinopathy progression via modulating retinal endothelial proliferation and apoptosis. [Abstract]2025 Jul 1;25(1):367. PMID: 40597930 -
Clin Appl Thromb Hemost
Clinical Value and Potential Molecular Mechanism of miR-373-3p in Coronary Atherosclerosis. [Abstract]2025 Jan-Dec:31:10760296251319953. PMID: 40116722 -
Oncol Lett
2024 Apr 10;27(6):262. PMID: 38646496 -
Cancer Biother Radiopharm
miR-223-3p Targets KIF4A and Promotes the Oxidative Stress-Mediated Apoptosis of Breast Cancer Cells. [Abstract]2025 Jun;40(5):323-338. PMID: 39914820 -
Tohoku J Exp Med
MiR-324-3p Drives Malignant Behaviors of Tumor Cells by Promoting M2 Macrophage Polarization in Laryngeal Squamous Cell Carcinoma. [Abstract]2025 Jun 26. PMID: 40571644 -
Purity & Documentation
-
Data Sheet (272 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2659 KB)
References
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)