miRNA inhibitors

miRNA inhibitors (4603):

Cat. No.	Product Name	CAS No.	Purity	Chemical Structure

HY-RI04602

MicroRNA Inhibitor Negative Control

MicroRNA Inhibitor Negative Control is a full-length nucleotide 2'-methoxy modified oligonucleotide, and can be used as a negative control.

RNA, (CAGUACUUUUGUGUAGUACAA) (full-length nucleotide 2'-methoxy modification)
RNA, (CAGUACUUUUGUGUAGUACAA) (full-length nucleotide 2'-methoxy modification)

MicroRNA Inhibitor Negative Control
MicroRNA Inhibitor Negative Control is a full-length nucleotide 2'-methoxy modified oligonucleotide, and can be used as a negative control.

HY-RI00053

hsa-miR-106a-3p inhibitor		98.75%
hsa-miR-106a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GUAAGAAGUGCUUACAUUGC) (full-length nucleotide 2'-methoxy modification) RNA, (GUAAGAAGUGCUUACAUUGC) (full-length nucleotide 2'-methoxy modification)

HY-RI00449

hsa-miR-21-5p inhibitor
hsa-miR-21-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UCAACAUCAGUCUGAUAAGC) (full-length nucleotide 2'-methoxy modification) RNA, (UCAACAUCAGUCUGAUAAGC) (full-length nucleotide 2'-methoxy modification)

HY-RI00510

hsa-miR-29a-3p inhibitor		98.24%
hsa-miR-29a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UAACCGAUUUCAGAUGGUGC) (full-length nucleotide 2'-methoxy modification) RNA, (UAACCGAUUUCAGAUGGUGC) (full-length nucleotide 2'-methoxy modification)

HY-RI00540

hsa-miR-30c-5p inhibitor
hsa-miR-30c-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GCUGAGAGUGUAGGAUGUUUA) (full-length nucleotide 2'-methoxy modification) RNA, (GCUGAGAGUGUAGGAUGUUUA) (full-length nucleotide 2'-methoxy modification)

HY-RI03422

mmu-miR-6415 inhibitor
mmu-miR-6415 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UGCAUGGGGCCCUCAAAAGC) (full-length nucleotide 2'-methoxy modification) RNA, (UGCAUGGGGCCCUCAAAAGC) (full-length nucleotide 2'-methoxy modification)

HY-RI03548

mmu-miR-6913-5p inhibitor
mmu-miR-6913-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CCAACACCUGACUGGUCUCC) (full-length nucleotide 2'-methoxy modification) RNA, (CCAACACCUGACUGGUCUCC) (full-length nucleotide 2'-methoxy modification)

HY-RI03566

mmu-miR-6922-3p inhibitor
mmu-miR-6922-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CUGUGAGAAGGGUGAGCAGAA) (full-length nucleotide 2'-methoxy modification) RNA, (CUGUGAGAAGGGUGAGCAGAA) (full-length nucleotide 2'-methoxy modification)

HY-RI02495

hsa-miR-887-3p inhibitor
hsa-miR-887-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CCUCGGGAUGGCGCCCGUUC) (full-length nucleotide 2'-methoxy modification) RNA, (CCUCGGGAUGGCGCCCGUUC) (full-length nucleotide 2'-methoxy modification)

HY-RI00190

hsa-miR-127-3p inhibitor
hsa-miR-127-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AGCCAAGCUCAGACGGAUCC) (full-length nucleotide 2'-methoxy modification) RNA, (AGCCAAGCUCAGACGGAUCC) (full-length nucleotide 2'-methoxy modification)

HY-RI03258

mmu-miR-511-3p inhibitor
mmu-miR-511-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AUCCUGUCUUUUGCUACACA) (full-length nucleotide 2'-methoxy modification) RNA, (AUCCUGUCUUUUGCUACACA) (full-length nucleotide 2'-methoxy modification)

HY-RI00138

hsa-miR-124-3p inhibitor
hsa-miR-124-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UUGGCAUUCACCGCGUGCCU) (full-length nucleotide 2'-methoxy modification) RNA, (UUGGCAUUCACCGCGUGCCU) (full-length nucleotide 2'-methoxy modification)

HY-RI00334

hsa-miR-181c-5p inhibitor
hsa-miR-181c-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACUCACCGACAGGUUGAAUG) (full-length nucleotide 2'-methoxy modification) RNA, (ACUCACCGACAGGUUGAAUG) (full-length nucleotide 2'-methoxy modification)

HY-RI00543

hsa-miR-30e-3p inhibitor
hsa-miR-30e-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GCUGUAAACAUCCGACUGAA) (full-length nucleotide 2'-methoxy modification) RNA, (GCUGUAAACAUCCGACUGAA) (full-length nucleotide 2'-methoxy modification)

HY-RI00701

hsa-miR-339-5p inhibitor
hsa-miR-339-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CGUGAGCUCCUGGAGGACAGG) (full-length nucleotide 2'-methoxy modification) RNA, (CGUGAGCUCCUGGAGGACAGG) (full-length nucleotide 2'-methoxy modification)

HY-RI01135

hsa-miR-4516 inhibitor
hsa-miR-4516 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GCCCCGACCCUUCUC) (full-length nucleotide 2'-methoxy modification) RNA, (GCCCCGACCCUUCUC) (full-length nucleotide 2'-methoxy modification)

HY-RI01139

hsa-miR-451a inhibitor
hsa-miR-451a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AACUCAGUAAUGGUAACGGU) (full-length nucleotide 2'-methoxy modification) RNA, (AACUCAGUAAUGGUAACGGU) (full-length nucleotide 2'-methoxy modification)

HY-RI01463

hsa-miR-488-5p inhibitor
hsa-miR-488-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UUGAGAGUGCCAUUAUCUG) (full-length nucleotide 2'-methoxy modification) RNA, (UUGAGAGUGCCAUUAUCUG) (full-length nucleotide 2'-methoxy modification)

HY-RI01868

hsa-miR-6124 inhibitor
hsa-miR-6124 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UCCUCCCCCUUCCUUUUC) (full-length nucleotide 2'-methoxy modification) RNA, (UCCUCCCCCUUCCUUUUC) (full-length nucleotide 2'-methoxy modification)

HY-RI02263

hsa-miR-6850-5p inhibitor
hsa-miR-6850-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CGCCCCGGCCAGCGUUCCGC) (full-length nucleotide 2'-methoxy modification) RNA, (CGCCCCGGCCAGCGUUCCGC) (full-length nucleotide 2'-methoxy modification)

Name
Email *

	Sorry, but the email address you supplied was invalid.