hsa-miR-152-3p antagomir
Based on 1 publication(s) in Google Scholar
hsa-miR-152-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:6944.48
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) hsa-miR-152-3p antagomir
More
Biological Activity
Chemical Information
-
Molecular Weight 6944.48
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
UCAGUGCAUGACAGAACUUGG
-
Stem-loop ID
hsa-mir-152
-
Stem-loop Sequence
UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGAAGGACC
-
Species
Human, Mouse, Rat, Alligator mississippiensis, Callithrix jacchus, Chrysemys picta, Cricetulus griseus, Dog, Gorilla gorilla, Guinea pig, Pan troglodytes, Pig, Pongo pygmaeus, Pteropus alecto, Rabbit, Rhesus monkey, Sheep, Tupaia chinensis
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
Adv Sci (Weinh)
WTAP Mediated m6A Modification Stabilizes PDIA3P1 and Promotes Tumor Progression Driven by Histone Lactylation in Esophageal Squamous Cell Carcinoma. [Abstract]2025 Sep;12(33):e06529. PMID: 40470706
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)