Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
46 Results for "
MOE
" in MedChemExpress (MCE) Product Catalog:
Products (46)
46 Results for "MOE" in MCE Product Catalog:
Research Areas:
DMT-2'O-MOE-rG(ib) Phosphoramidite belongs to cyanoethyl-protected nucleoside phosphoramidites. DMT-2'O-MOE-rG(ib) Phosphoramidite is a derivative of nucleotide and guanosine. DMT-2'O-MOE-rG(ib) Phosphoramidite can be used for the stereochemical synthesis of phosphorothioate oligonucleotides .
Research Areas:
DMT-2'-O-MOE-rA(Bz) phosphoramidite is an adenine nucleoside analog. DMT-2'-O-MOE-rA(Bz) phosphoramidite can be used in research on oligonucleotide synthesis .
Synonyms: AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium
Target:
Research Areas:
Pelacarsen sodium (ISIS 681257 sodium) is a GalNAc3-conjugated 2′-MOE-modified antisense oligonucleotide. Pelacarsen sodium reduces apo (a) .
Cat. No.: HY-W048488
CAS No.: 163759-49-7
Target:
Research Areas:
2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
Cat. No.: HY-23789
CAS No.: 473278-54-5
Synonyms: 2'-O-MOE-rG
Cat. No.: HY-W570885
CAS No.: 251647-54-8
Target:
Research Areas:
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
Cat. No.: HY-W570886
CAS No.: 163759-97-5
Target:
Research Areas:
2'-O-MOE-U is a nucleic acid modification group (Phosphoramidite) with 3'-exonuclease inhibitory activity. 2'-O-MOE-U also exhibits gene silencing activity and double-stranded oligonucleotide stability. By forming steric interactions with 3'-exonuclease residues, 2'-O-MOE-U anchors the 3'-end of the siRNA guide strand in the hAgo2 PAZ domain, thereby regulating double-stranded thermal stability and enhancing base-pairing specificity. 2'-O-MOE-U does not induce IFNα production, can be incorporated at multiple sites of siRNA to enhance RNAi activity, and produces a synergistic effect with 2'-F modification. 2'-O-MOE-U has been widely used in studies related to breast cancer and other diseases .
Cat. No.: HY-W570890
CAS No.: 163759-94-2
Target:
Research Areas:
2'-O-MOE-5-Me-C(Bz) is a nucleotide analog that can be used for the synthesis of oligonucleotides.
Target:
Research Areas:
2'-O-MOE-5MeU-3'-phosphoramidite is a phosphoramidite derivative that can be used for oligonucleotide synthesis .
Cat. No.: HY-151123
CAS No.: 1637637-70-7
Synonyms: AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
Target:
Research Areas:
Pelacarsen (ISIS 681257) is a GalNAc3-conjugated 2′-MOE-modified antisense oligonucleotide. Pelacarsen reduces apo (a) .
Cat. No.: HY-159695A
Synonyms: ISIS 426115 sodium
Target:
Research Areas:
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
Cat. No.: HY-W415798
CAS No.: 1810852-60-8
Target:
Cat. No.: HY-154368
Target:
Research Areas:
DMTr-MOE-Inosine-3-CED-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
Cat. No.: HY-154545
CAS No.: 256223-93-5
Research Areas:
3’-O-MOE-5MeU-2’-phosphoramidite is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Cat. No.: HY-W048497
CAS No.: 244105-55-3
Target:
Research Areas:
2'-O-MOE-5-Me-rC is an active compound. 2'-O-MOE-5-Me-rC can be used for oligonucleotide synthesis .
Cat. No.: HY-154549
CAS No.: 256224-06-3
Research Areas:
3’-O-MOE-G(iBu)-2’-phosphoramidite is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
Cat. No.: HY-159695
CAS No.: 1431900-72-9
Synonyms: ISIS 426115
Target:
Research Areas:
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
Cat. No.: HY-171519
CAS No.: 205988-02-9
Target:
Research Areas:
2′-O-MOE-CMP is a nucleotide analog that can be used in the synthesis of oligonucleotides.
Cat. No.: HY-171530
CAS No.: 847647-85-2
Target:
Research Areas:
2'-O-MOE-GTP is a nucleotide analog that can be used in the synthesis of oligonucleotides.
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
