1. Search Result
Search Result
Results for "

murine immunoglobulin A J539 (Fab' fragment)

" in MedChemExpress (MCE) Product Catalog:

1459

Inhibitors & Agonists

33

Screening Libraries

12

Fluorescent Dyes

66

Biochemical Assay Reagents

524

Peptides

6

MCE Kits

228

Inhibitory Antibodies

141

Natural
Products

235

Recombinant Proteins

24

Isotope-Labeled Compounds

103

Antibodies

17

Click Chemistry

27

Oligonucleotides

1

GMP Molecules

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-P99367

    DS-7300a Antibody; MABX-9001A Antibody

    CD276/B7-H3 Inflammation/Immunology Cancer
    Ifinatamab is monoclonal immunoglobulin G1-kappa with anti-human B7 homolog 3 protein (Human B7-H3). Ifinatamab is a glycoforme α immunomodulateur .
    Ifinatamab
  • HY-P99955

    AMG 451; KHK4083

    Orexin Receptor (OX Receptor) Infection Inflammation/Immunology
    Rocatinlimab (AMG 451) (KHK4083) is a fully human immunoglobulin G1 (IgG1) anti-OX40 monoclonal antibody. Rocatinlimab can be used for the research of atopic dermatitis (AD) .
    Rocatinlimab
  • HY-P99901

    VIS649

    SARS-CoV Inflammation/Immunology Cancer
    Sibeprenlimab (VIS649) is a humanized IgG2 monoclonal antibody which inhibits a proliferation-inducing ligand (APRIL). Sibeprenlimab suppresses pathogenic immunoglobulins (IgA and IgM), while preserving antibody responses to mRNA-based vaccines against SARS-COV-2. Sibeprenlimab reduces urinary protein-to-creatinine ratio (UPCR) and glomerular filtration rate (GFR). Sibeprenlimab is promising for the research of IgA nephropathy (IgAN) .
    Sibeprenlimab
  • HY-NP006
    Protein A
    1 Publications Verification

    SPA

    Endogenous Metabolite Apoptosis Inflammation/Immunology
    Protein A (SPA) is an immunoglobulin (Ig)-binding protein that exists on the bacterial surface and can be freely secreted into the extracellular environment. Protein A blocks opsonophagocytosis and induces B cell apoptosis in vitro by binding to the Fc region of antibodies and the Fab region of B cell receptors. Protein A can form toxic immune complexes with IgG, thereby inducing leukocyte necrosis. Protein A contributes to the virulence expression of Staphylococcus aureus. Protein A triggers allergic reactions in IgG-pretreated mouse models. Protein A can be used in studies related to immune system diseases .
    Protein A
  • HY-E70194

    V8 protease; Glu-C

    Ser/Thr Protease Others
    Endoproteinase Glu-C (MS grade) is a serine proteinase. Endoproteinase GluC is able to hydrolyze some serpins and all classes of mammalian immunoglobulins .
    Endoproteinase Glu-C (MS grade)
  • HY-P99721

    ABT-981

    Interleukin Related Inflammation/Immunology
    Lutikizumab (ABT-981) is an anti-IL-1α and IL-1β dual variable domain immunoglobulin. Lutikizumab binds and inhibits IL-1α and IL-1β. Lutikizumab can be used for the research of osteoarthritis .
    Lutikizumab
  • HY-P990047

    AMG133 antibody

    ADC Antibody GLP Receptor Metabolic Disease
    Maridebart (AMG133 antibody) is a human immunoglobulin G1-kappa, anti-GIPR (gastric inhibitory polypeptide receptor) monoclonal antibody. Maridebart is the antibody portion of Maridebart cafraglutide (HY-164535) and can be used for the synthesis of antibody-drug conjugates (ADC). Maridebart can be used for the reserrch of obesity and type 2 diabetes .
    Maridebart
  • HY-114164G

    Thrombin Protease Activated Receptor (PAR) MMP VEGFR Epigenetic Reader Domain Cardiovascular Disease Neurological Disease Inflammation/Immunology
    Murine Thrombin is a murine serine protease that plays a central role in blood coagulation. Murine Thrombin stimulates macrophages to polarize into a unique phenotype characterized by anti-inflammatory and pro-repair properties. Murine Thrombin activates PAR1, induces the production of MCP-1, MMP3 and VEGF in mouse intervertebral discs, and causes degradation of the cartilage matrix and destruction of intervertebral disc structure. Murine Thrombin activity increases significantly in paraoxon-induced status epilepticus .
    Murine Thrombin
  • HY-P99644
    ACT017
    1 Publications Verification

    Glycoprotein VI Cardiovascular Disease
    ACT017 is a Fab fragment of humanized anti-GPVI monoclonal antibody. ACT017 inhibits collagen-induced platelet aggregation. ACT017 has the potential for the research of acute ischemic stroke .
    ACT017
  • HY-P99036

    Tie Cardiovascular Disease Inflammation/Immunology Cancer
    Nesvacumab is a fully human immunoglobulin G1 (IgG1) monoclonal antibody that specifically binds and inactivates the Tie2 receptor ligand Angiopoietin-2 (Ang2) with high affinity, but shows no binding to Ang1. Nesvacumab can be used in vascular researches .
    Nesvacumab
  • HY-125864B

    MMP Cadherin Cardiovascular Disease Neurological Disease
    Murine Fibrinogen is a native fibrinogen derived from mouse plasma. Murine Fibrinogen acts as a cerebrovascular permeability enhancer. Murine Fibrinogen activates matrix metalloproteinase-9 (MMP-9), downregulates the expression of vascular endothelial cadherin (VE-cadherin), and upregulates the expression of plasmalemmal vesicle-associated protein-1 (PV-1). Murine Fibrinogen increases macromolecular leakage from pial veins, thereby disrupting the microvascular integrity of cerebral blood vessels. Murine Fibrinogen can be used in studies related to cerebrovascular dysfunction .
    Murine Fibrinogen
  • HY-P99629

    FHTR 2163; RG 6147; RO 7171009

    Ser/Thr Protease Neurological Disease
    Galegenimab (FHTR 2163) is a humanized monoclonal antibody Fab fragment targeting the HtrA1 trimer. Galegenimab is used in research on age-related macular degeneration (AMD) .
    Galegenimab
  • HY-P1290
    PKA Inhibitor Fragment (6-22) amide
    5 Publications Verification

    PKI-(6-22)-amide

    PKA Neurological Disease
    PKA Inhibitor Fragment (6-22) amide is a highly potent and specific competitive inhibitor of PKA, with Ki values of 1.7 nM and 1.6 nM against human and bovine PKA catalytic subunits, respectively. The IC50 of PKA Inhibitor Fragment (6-22) amide targeting bovine PKA is 8.6 nM. PKA Inhibitor Fragment (6-22) amide effectively abolishes PKA activity in mouse brain and spinal cord, and exerts in vivo efficacy via intracerebroventricular administration. PKA Inhibitor Fragment (6-22) amide significantly reverses low-dose morphine analgesic tolerance in mice and blocks photoaffinity labeling of cAMP-dependent protein kinase. PKA Inhibitor Fragment (6-22) amide can be applied to research in fields related to the mechanism of morphine analgesic tolerance and skin wound healing .
    PKA Inhibitor Fragment (6-22) amide
  • HY-P0132
    YIGSR
    1 Publications Verification

    Laminin Fragment 929-933

    NO Synthase Cancer
    YIGSR (Laminin Fragment 929-933) is a polypeptide that inhibits tumor growth and metastasis of leukemia cells. YIGSR specifically binds to the 67kDa laminin receptor and regulates the expression of eNOS in endothelial cells. YIGSR can be used in leukemia-related research .
    YIGSR
  • HY-P2975

    Mouse laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)

    Endogenous Metabolite Biochemical Assay Reagents Neurological Disease
    Laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.
    Laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)
  • HY-P99155

    2F8; HUMAX-EGFR

    EGFR Cancer
    Zalutumumab is a high affinity, completely human IgG1 monoclonal antibody targeting EGFR. Zalutumumab binds to domain III of the EGF receptor and acts by blocking the binding of EGF and by sterically interfering with the active conformation of the receptor. Zalutumumab binds with IgG and its Fab fragment with EC50s of 7 and 19 nM, respectively. Zalutumumab can be used for the research of cancer .
    Zalutumumab
  • HY-NP0196

    Mouse IgG

    Biochemical Assay Reagents Inflammation/Immunology
    Mouse Immunoglobulin G (Mouse IgG) is a mouse serum immunoglobulin that can be used in immunolabeling and coating protein in a variety of immunoassays including ELISA .
    Mouse immunoglobulin G
  • HY-P99879

    Benegrastim; Bineuta; F 627

    STAT Inflammation/Immunology
    Efbemalenograstim alfa (F 627) is a recombinant fusion protein. Efbemalenograstim alfa is a long acting dimeric granulocyte colony-stimulating factor (G-CSF) that contains two human G-CSF fused to a human immunoglobulin G2 (hIgG2)-Fc fragment with a peptide linker. Efbemalenograstim alfa induces the production of white blood cells .
    Efbemalenograstim alfa
  • HY-NP143

    Biochemical Assay Reagents Neurological Disease
    Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .
    Nerve Growth Factor 2.5S,murine submaxillary gland
  • HY-P4086

    RABV nAChR Neurological Disease Cancer
    Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R) is a cell-penetrating peptide that is synthesized by adding nona-arginine motif to the carboxy terminus of RVG (rabies virus glycoprotein). Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R) binds to
    nAChR
    on neuronal cells to mediate receptor-mediated endocytosis and targeted siRNA delivery. Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R) protects complexed siRNA from degradation, enhances transcellular siRNA delivery in neuronal cells, and promotes efficient, pecific gene silencing. Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R) can be used for the researches of neurological disease and cancer .
    Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R)
  • HY-P1290A
    PKA Inhibitor Fragment (6-22) amide TFA
    5 Publications Verification

    PKI-(6-22)-amide TFA

    PKA Neurological Disease
    PKA Inhibitor Fragment (6-22) amide TFA is an inhibitor of cAMP-dependent protein kinase A (PKA), with a Ki of 2.8 nM. PKA Inhibitor Fragment (6-22) amide TFA can significantly reverse antinociceptive tolerance in mice .
    PKA Inhibitor Fragment (6-22) amide TFA
  • HY-P990785

    ABBV-383; TNB 383B

    CD3 Cardiovascular Disease Inflammation/Immunology Cancer
    Etentamig is a BCMA × CD3 bispecific T-cell engager (BiTE) that can inhibit the activity of B-cell maturation antigen (BCMA) and activate the T-cell surface glycoprotein CD3 complex. Etentamig can be used for research in multiple myeloma, immunoglobulin light chain amyloidosis, and cardiovascular diseases .
    Etentamig
  • HY-18169

    Fab-001

    Bacterial Infection
    MUT056399 (Fab-001) is a highly potent inhibitor of the FabI enzyme of both S. aureus and E. coli with 50% inhibitory concentration IC50s of 12 nM and 58 nM, respectively.
    MUT056399
  • HY-P5003

    MMP Inflammation/Immunology
    Collagen Type II Fragment is an anti-inflammatory peptide that potently inhibits collagen-induced arthritis (CIA) in mice. Collagen Type II Fragment can be used for research on inflammation and immunity .
    Collagen Type II Fragment
  • HY-P4190

    GnRH Receptor Endocrinology
    FSH receptor-binding inhibitor fragment(bi-10) is a potent FSH antagonist. FSH receptor-binding inhibitor fragment(bi-10) blocks the binding of FSH to FSHR, and alteres FSH action at the receptor level. FSH receptor-binding inhibitor fragment(bi-10) results in the suppression of ovulation and causes follicular atresia of mice. FSH receptor-binding inhibitor fragment(bi-10) has the potential for utilizing to restrain the carcinogenesis of ovarian cancer by down-regulating overexpression of FSHR and ERβ in the ovaries .
    Fsh receptor-binding inhibitor fragment(bi-10)
  • HY-N9439

    Endogenous Metabolite Others
    6-O-β-D-Galactopyranosyl-D-galactose, a disaccharide, is a part of the polysaccharide main chain with β-(1→6)-glycoside bonds with a side chain bonded to the main one by the β-(1→3) bond. 6-O-β-D-Galactopyranosyl-D-galactose can be isolated from enzyme-hydrolyzed peach gum .
    6-O-β-D-Galactopyranosyl-D-galactose
  • HY-P1921

    Integrin Thrombin Cardiovascular Disease
    YRGDS Fibronectin Fragment is a fibronectin fragment, an adhesion peptide that displays strong binding affinity to thrombin-stimulated platelets .
    YRGDS Fibronectin Fragment
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) sodium
  • HY-NP0200

    Dog IgG

    Inflammation/Immunology
    Dog Immunoglobulin G (Dog IgG) is a dog serum immunoglobulin that can be used in immunolabeling and coating protein in a variety of immunoassays including ELISA .
    Dog Immunoglobulin G
  • HY-P1582A

    Adrenocorticotropic Hormone Fragment 1-14 TFA

    Adrenergic Receptor Others
    ACTH (1-14) (TFA) is a fragment of adrenocorticotrophin, which regulates cortisol and androgen production .
    ACTH (1-14) TFA
  • HY-108795

    GLP-1-Gly8; GLP-1 (7-36) analog

    GLP Receptor Metabolic Disease
    Albiglutide fragment (GLP-1 (7-36) analog) is an active fragment of Albiglutide (7-36) and a glucagon-like peptide-1 (GLP-1) analog (a long-acting GLP-1 receptor agonist). Albiglutide is produced by the fusion of DPP-4 resistant GLP-1 dimer with the human albumin gene. Moreover, Albiglutide fragment significantly reduces glycosylated hemoglobin (A1C) and is used in type 2 diabetes (T2D) studies .
    Albiglutide fragment
  • HY-P990021

    TRL1068

    Bacterial Others
    Calpurbatug is an immunoglobulin G1 antibody. Calpurbatug has activity with anti-bacterial DNA-binding protein DNABII family and anti-human monoclonal TRL1068 γ1-chain .
    Calpurbatug
  • HY-E70364

    Biochemical Assay Reagents Inflammation/Immunology
    IgdE protease is a cysteine protease, which is initially isolated from Streptococcus agalactiae. IgdE protease digests monoclonal antibodies (mAbs) of the IgG1 type specifically at their upper hinge region, produces Fc/2, hinge peptide dimers, and Fab fragment. IgdE protease can be used in disulfide bonds and free thiol analysis, as it requires no reducing agents for cleavage .
    IgdE protease
  • HY-P99938

    HX008

    PD-1/PD-L1 Cancer
    Pucotenlimab (HX008) is a humanized immunoglobulin G4 (IgG4) anti programmed cell death protein 1 (anti-PD-1) monoclonal antibody. Pucotenlimab can be used for the research of tumor .
    Pucotenlimab
  • HY-NP0195

    Sheep IgG

    Inflammation/Immunology
    Sheep Immunoglobulin G (Sheep IgG) is a sheep serum immunoglobulin that can be used in immunolabeling and coating protein in a variety of immunoassays including ELISA .
    Sheep immunoglobulin G
  • HY-NP0198

    Rabbit IgG

    Biochemical Assay Reagents Inflammation/Immunology
    Rabbit Immunoglobulin G (Rabbit IgG) is a rabbit serum immunoglobulin that can be used in immunolabeling and coating protein in a variety of immunoassays including ELISA .
    Rabbit Immunoglobulin G
  • HY-E70216

    Others Others
    Bsu DNA polymerase, Large fragment is a polymerase derived from Bacillus subtilis. Bsu DNA polymerase, Large fragment is a DNA isothermal amplification polymerase with chain replacement activity, which used in RPA recombinase polymerase amplification technology .
    Bsu DNA polymerase, Large fragment
  • HY-P5455

    LIM Kinase (LIMK) Others
    S3 Fragment is a biological active peptide. (This peptide contains the unique amino-terminal phosphorylation site of Xenopus ADF/cofilin, the LIM kinase (LIMK) phosphorylation site. LIMK1 is a key regulator of the actin cytoskeleton through its phosphorylation of ADF/cofilin at serine-3 for inactivation. This peptide is a fragment of the S3 peptide containing the serine-3 sequence of ADF/cofilin that has been widely used as an effective competitive inhibitor of LIMK1.)
    S3 Fragment
  • HY-P990048

    ADG126

    CTLA-4 Cancer
    Muzastotug is a humanized immunoglobulin G1-kappa, anti-CTLA4 monoclonal antibody. Muzastotug is an immunostimulant and antineoplastic .
    Muzastotug
  • HY-NP144

    Biochemical Assay Reagents Neurological Disease
    Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .
    Nerve Growth Factor 7S,murine submaxillary gland
  • HY-P99436

    ABR-214936

    Transmembrane Glycoprotein Cardiovascular Disease Inflammation/Immunology Cancer
    Anatumomab mafenatox (ABR-214936) is a 73 KDa recombinant protein to recognize the tumor-associated antigen 5T4, which is widely expressing in malignancy. Anatumomab mafenatox is between a modified form of SEA and a murine Fab. The main side effects of Anatumomab mafenatox are reported to include fever, low blood pressure, pain, nausea and drowsiness .
    Anatumomab mafenatox
  • HY-NP193A

    Fc Receptor (FcR) Inflammation/Immunology
    Rat IgG Fc fragment is a crystallizable fragment (Fc) of rat immunoglobulin G (IgG) molecules that can be used as an immunolabel in various immunoassays, including ELISA.
    Rat IgG Fc fragment
  • HY-P11153

    Estrogen Receptor/ERR Cancer
    HGH fragment 176-191 is a fragment of Human Growth Hormone. HGH fragment 176-191 binds with high affinity to Ki-67, MiB protein, and the estrogen receptor. HGH fragment 176-191 enhances the toxicity of Doxorubicin (HY-15142A)-loaded Chitosan nanoparticles against breast cancer .
    HGH fragment 176-191
  • HY-P2728A

    Biochemical Assay Reagents Cardiovascular Disease
    Murine Antithrombin III is a blood coagulation inhibitory enzyme with high catalytic efficiency, high specificity, mild action conditions, etc., and can be used in the pharmaceutical industry, industrial production, food manufacturing, aquaculture and other industries .
    Murine Antithrombin III
  • HY-P99606

    ZTS-00521426

    TGF-beta/Smad Inflammation/Immunology
    Cirevetmab (ZTS-00521426) is an immunoglobulin G2-kappa, Canis lupus familiaris TGFB1 caninized monoclonal antibody. Cirevetmab is an immunomodulator .
    Cirevetmab
  • HY-P1288

    PKC fragment (530-558)

    PKC Others
    Protein Kinase C (530-558), a peptide fragment of protein kinase C (PKC), is a potent PKC activator. Protein Kinase C (530-558) significantly inhibits osteoclastic bone resorption .
    Protein Kinase C (530-558)
  • HY-P991678

    XENP-27564; XMAB-27564

    Interleukin Related Inflammation/Immunology
    Efpixileukin alfa is a fusion protein that combines human IL-2 variant fused at the C-terminus to human immunoglobulin G1 (IgG1) Fc fragment. Efpixileukin alfa is an immunomodulator .
    Efpixileukin alfa
  • HY-NP0198B

    Fc Receptor (FcR) Inflammation/Immunology
    Rabbit IgG Fab fragment is a fragment of antigen (Fab) of rabbit immunoglobulin G (IgG) molecules that can be used as an immunolabel in various immunoassays, including ELISA.
    Rabbit IgG Fab fragment
  • HY-NP0196E

    Fc Receptor (FcR) Inflammation/Immunology
    Mouse IgG Fab fragment is a fragment of antigen (Fab) of mouse immunoglobulin G (IgG) molecules that can be used as an immunolabel in various immunoassays, including ELISA.
    Mouse IgG Fab fragment
  • HY-NP0197A

    Fc Receptor (FcR) Inflammation/Immunology
    Goat IgG Fc fragment is a crystallizable fragment (Fc) of goat immunoglobulin G (IgG) molecules that can be used as an immunolabel in various immunoassays, including ELISA.
    Goat IgG Fc fragment

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: