- Oligonucleotides
- Antisense Oligonucleotides
Antisense Oligonucleotides
Antisense Oligonucleotides (ASOs) usually refer to short, synthetic, single-stranded DNA or RNA (13-30 nucleotides). Following binding to the targeted mRNA or pre-mRNA, ASOs modulates RNA function by several different mechanisms.
1. ASOs can form an RNA–DNA hybrid that becomes a substrate for RNase H, resulting in target mRNA degradation.
2. ASOs can modulate gene expression via steric block of the ribosomal machinery, which can lead to reduced expression, modulation of splicing and/or restoration of a functional protein.
3. Binding of ASOs to pre-mRNA can alter splicing factor recruitment and regulate splicing events.
The first in vivo applications of ASOs showed limited clinical potential because of the high susceptibility of ASOs with an unmodified phosphoribose backbone to rapid degradation by endonucleases and exonucleases. The modifications in backbone, and sugar molecules give ASOs more affinity and stability. Phosphorodiamidate morpholino oligomers (PMO) are very resistant to nuclease and protease degradation and are mostly used in splicing modulation or translation inhibition. Chemical modifications at 2' position of ribose sugar ring such as 2’-O-methyl (2’-O-me), 2’-Fluoro (2’-F), 2’-O-methoxyethyl (2’-MOE) allow oligonucleotide to adopt RNA like C3’-endo sugar pucker, making it thermally stable.
-
Antisense Oligonucleotides (606)
- Molecular Weight: 7179.15 (free acid)
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH).
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 6682.4 (free acid)
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C234H322N61Na18O128P17S17
- Molecular Weight: 7127.3 (free acid)
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C234H340N61O128P17S17
- Molecular Weight: 7127.19
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy.
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 7128.00
Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C268H402N124Na22O95P22
- Molecular Weight: 7584.00
Casimersen (SRP-4045) sodium is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen sodium binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen sodium can be used for the research of Duchenne muscular dystrophy (DMD).
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 7584.00
Casimersen (SRP-4045) is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen can be used for the research of Duchenne muscular dystrophy (DMD).
August 31
-
Please select quantity
August 31
Get Quote
Mipomersen sodium scrambled negative control is the sequence scrambled negative control of Mipomersen sodium.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C230H298N72Na19O123P19S15
- Molecular Weight: 7128 (free acid)
Tofersen (BIIB067) sodium is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen sodium mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen sodium downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen sodium can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C95H115F3N32O51P8S8
- Molecular Weight: 3082.42
RGLS4326 (RG4326) is a first-in-class, short oligonucleotide inhibitor of microRNA-17 (miR-17). RGLS4326 can be used for the research of autosomal dominant polycystic kidney disease (ADPKD). RGLS4326 inhibits miR-17 function in HeLa cells with an EC50 value of 28.3 nM.
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 7183.08 (free acid)
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C230H290N88Na19O115P19S19
- Molecular Weight: 7344 (free acid)
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 7165.00
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C230H301N63Na19O125P19S19
- Molecular Weight: 7165 (free acid)
Volanesorsen (ISIS 304801) sodium is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen sodium is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C364H569N177O122P30
- Molecular Weight: 10305.74
Eteplirsen (AVI 4658) is a phosphorylated diamine morpholino oligonucleotide that targets exon 51 of the human Duchenne muscular dystrophy (DMD) gene. Eteplirsen induces exon 51 skipping, causing it to be skipped during splicing, thereby restoring the translation reading frame and producing a shortened functional dystrophin. Eteplirsen can be used in research on Duchenne muscular dystrophy.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C234H317N71Na17O124P17S17
- Molecular Weight: 7197.2 (free acid)
Zorevunersen sodium is an antisense oligonucleotide targeting the Scn1a gene based on TANGO technology. Zorevunersen sodium increases Scn1a mRNA transcripts and elevates the expression level of NaV1.1 protein. Zorevunersen sodium restores the excitability of PV interneurons, thereby reducing seizures and prolonging survival in mice. Zorevunersen sodium can be used for research on Dravet syndrome.
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 4689.85 (free acid)
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 7346.00
Custirsen (OGX-011) is an antisense oligonucleotide that targets clusterin mRNA. Custirsen induces apoptosis by activating Bax, triggering mitochondrial translocation and cytochrome c release. Custirsen acts as a chemosensitizer, radiosensitizer and hormone sensitizer. Custirsen can be used in research related to prostate cancer, non-small cell lung cancer and metastatic breast cancer.
August 31
-
Please select quantity
August 31
Get Quote
- Molecular Weight: 5422.00
Danvatirsen (AZD9150) is an antisense oligonucleotide targeting STAT3. Danvatirsen reduces the viability and promotes apoptosis of leukemia cell lines. Danvatirsen inhibits the expression of endogenous STAT3 and its downstream target genes, and reduces the proliferation and tumorigenicity of neuroblastoma and lymphoma cells. Danvatirsen inhibited tumor growth in mouse models of neuroblastoma, lymphoma, and non-small cell lung cancer. Danvatirsen achieves STAT3 mRNA and protein depletion in a mouse model of epidermoid carcinoma. Danvatirsen can be used in research related to lymphoma, myelodysplastic syndrome, acute myeloid leukemia, neuroblastoma and non-small cell lung cancer.
August 31
-
Please select quantity
August 31
Get Quote
- Formula: C200H241N69O107P20S20Na20
- Molecular Weight: 6604 (free acid)
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice.
August 31
-
Please select quantity
August 31
Get Quote