![TGA-Val-Ala-NH2-bicyclo[1.1.1]pentane-7-MAD-MDCPT](https://file.medchemexpress.com/product_pic/hy-171946.gif "Click to View TGA-Val-Ala-NH2-bicyclo[1.1.1]pentane-7-MAD-MDCPT Product Detail")
Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
15 Results for "
TGA
" in MedChemExpress (MCE) Product Catalog:
Products (15)
15 Results for "TGA" in MCE Product Catalog:
12
12 Publications Verification
Synonyms: CpG 1826
Research Areas:
ODN 1826 is a class B CpG ODN (oligodeoxynucleotide) and TLR9 agonist. ODN 1826 induces NO and iNOS production and enhances Apoptosis. ODN 1826 enhances immune surveillance. ODN 1826 increases aortic atherosclerotic plaque size. ODN 1826 has antitumor activity against lung cancer, glioma and melanoma .
2
Target:
Research Areas:
ODN 1018 (1018 ISS) is a TLR9 agonist and immune modulator. ODN 1018 exhibits adjuvant activity and augments CD8+ T cell responses with LNP-encapsulated OVA peptides. ODN 1018 triggers sustained suppression of allergic airway inflammation. ODN 1018 can be used for the research of allergic asthma and systemic lupus erythematosus .
1
1 Cited Publications
Target:
Research Areas:
ODN 1668, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 has strong immune regulatory properties, can enhance the level of antibody IgG2 subtype, promote the immune response of T cells and B cells, and can be used in the study of vaccine adjuvants. In addition, CpG ODN 1668 induces an antimicrobial immune response via a CaTLR9 dependent pathway in groupers. Sequence: 5'-tccatgacgttcctgatgct-3’ .
1
1 Cited Publications
Synonyms: ISIS 3521 sodium
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
1
1 Cited Publications
Target:
Research Areas:
GJ071 oxalate induces ATM kinase activity in ataxia telangiectasia (A-T) cells carrying homozygous TGA or TAG stop codons .
Cat. No.: HY-150725
CAS No.: 386832-46-8
Target:
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .
Synonyms: ISIS-420915 sodium
Target:
Research Areas:
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-150750
CAS No.: 934655-87-5
Target:
Research Areas:
ODN M362, a class C oligodeoxynucleotide, is a TLR-9 agonist and can be used as a vaccine adjuvant. ODN M362 induces cancer cell apoptosis .
Cat. No.: HY-RS14270
Target:
Research Areas:
TBX1 Human Pre-designed siRNA Set A contains three designed siRNAs for TBX1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
Cat. No.: HY-161016
CAS No.: 876013-29-5
Target:
Research Areas:
TNF/IFN-γ-IN-1 (compound TGA) is a dual inhibitor of TNF and IFN-γ. TNF/IFN-γ-IN-1 can used in study Alzheimer’s disease .
Cat. No.: HY-171946
CAS No.: 2857037-73-9
Research Areas:
TGA-Val-Ala-NH2-bicyclo[1.1.1]pentane-7-MAD-MDCPT is a drug-linker conjugate for ADC. TGA-Val-Ala-NH2-bicyclo[1.1.1]pentane-7-MAD-MDCPT consists of a topoisomerase 1 inhibitor (Topi MF-6) (HY-175203) and a cleavable linker (Maleimide-Ph(3,5-F)-PEG4-Val-Ala) (HY-175218). TGA-Val-Ala-NH2-bicyclo[1.1.1]pentane-7-MAD-MDCPT can be used for synthesis of ADCs .
Cat. No.: HY-187463
CAS No.: 2812383-82-5
Target:
Research Areas:
JAK-IN-42 is a JAK inhibitor that can be used in research related to JAK-abnormal diseases, such as rheumatoid arthritis .
- 1
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
