Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
31 Results for "
GAA
" in MedChemExpress (MCE) Product Catalog:
Products (31)
31 Results for "GAA" in MCE Product Catalog:
3
3 Cited Publications
Target:
Research Areas:
ODN 2088 is a potent TLR3, TLR7 and TLR9 inhibitor. ODN 2088 shows no cytotoxic. ODN 2088 inhibits the release of IFN-α and IL-6 .
2
Target:
Research Areas:
ODN 1018 (1018 ISS) is a TLR9 agonist and immune modulator. ODN 1018 exhibits adjuvant activity and augments CD8+ T cell responses with LNP-encapsulated OVA peptides. ODN 1018 triggers sustained suppression of allergic airway inflammation. ODN 1018 can be used for the research of allergic asthma and systemic lupus erythematosus .
1
1 Cited Publications
Research Areas:
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
1
1 Cited Publications
Target:
Research Areas:
ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
1
Target:
Research Areas:
Emapticap pegol (NOX-E36) is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36). mNOX-E36 is a murine-specific analogue of NOX-E36, an anti-MCP-1 L-RNA aptamer that was previously shown to attenuate liver fibrosis in mice .
Synonyms: AVI 4658
Target:
Research Areas:
Eteplirsen (AVI 4658) is a phosphorylated diamine morpholino oligonucleotide that targets exon 51 of the human Duchenne muscular dystrophy (DMD) gene. Eteplirsen induces exon 51 skipping, causing it to be skipped during splicing, thereby restoring the translation reading frame and producing a shortened functional dystrophin. Eteplirsen can be used in research on Duchenne muscular dystrophy .
Synonyms: SRP-4053
Target:
Research Areas:
Golodirsen (SRP-4053) is an antisense oligonucleotide of the phophorodiamidate morpholino oligomer (PMO). Golodirsen restores the reading frame of the Duchenne muscular dystrophy (DMD) gene by modifying the splicing process of the pre-mRNA, skipping exon 53. Golodirsen can restore the expression of the anti-myostatin protein. Golodirsen can be used for the research of duchenne muscular dystrophy (DMD) .
Cat. No.: HY-132586
CAS No.: 2055732-84-6
Synonyms: NS-065/NCNP-01
Research Areas:
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
Synonyms: ISIS-420915 sodium
Target:
Research Areas:
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-150750
CAS No.: 934655-87-5
Target:
Research Areas:
ODN M362, a class C oligodeoxynucleotide, is a TLR-9 agonist and can be used as a vaccine adjuvant. ODN M362 induces cancer cell apoptosis .
Cat. No.: HY-145725A
CAS No.: 1698048-23-5
Synonyms: ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
Target:
Research Areas:
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
0 Images
DNA, d(P-thio)([2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]m5rC-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-G-A-A-T-G-T-m5C-m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]G-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]A-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA), sodium salt (1:15)
Synonyms: IONIS 598769 sodium; ISIS 598769 sodium
Cat. No.: HY-147412
CAS No.: 2642382-41-8
Synonyms: QR-421a
Research Areas:
Ultevursen (QR-421a) is a splice-modulating antisense oligonucleotide targeting exon 13 of the USH2A gene, which restores the functional expression of Usherin protein by inducing exon skipping. Ultevursen binds to USH2A pre-mRNA and modulates the splicing process to specifically skip exon 13 carrying the pathogenic mutation c.2299delG, generating an in-frame transcript and a truncated yet functionally normal protein. Ultevursen exhibits concentration-dependent exon skipping activity in human cells and retinal organoid models, and restores Usherin expression and retinal function in zebrafish and gene-edited mouse models. Ultevursen can be used for related research on type 2 Usher syndrome and non-syndromic retinitis pigmentosa .
Synonyms: SYL1001
Research Areas:
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1) mRNA .
Cat. No.: HY-E70183
Synonyms: EC:3.2.1.20; GAA
Cat. No.: HY-132602
CAS No.: 1848266-71-6
Synonyms: MRG-201
Target:
Research Areas:
Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis .
Cat. No.: HY-178202
CAS No.: 2734265-58-6
Target:
Research Areas:
5-C-phenethyl-DNJ is a selective α-glucosidase GAA inhibitor, with its Ki value for rhGAA being 0.81 μM. 5-C-phenethyl-DNJ exhibits extremely high selectivity for GANAB, GBA1, and GBA2. 5-C-phenethyl-DNJ can be used for the study of Pompe disease .
Cat. No.: HY-150744
CAS No.: 1964506-30-6
Target:
Research Areas:
ODN 24888 is an guanine-modified inhibitory oligonucleotides (INH-ODN), shows potent inhibition on TLR7/TLR9-mediated signaling. ODN 24888 impairs IFN-α level and NF-κB activation, inhibits IL-6 release. ODN 24888 involves in immune and inflammatory responses, can be used as a vaccine adjuvant .
Cat. No.: HY-144124
CAS No.: 2734265-63-3
Target:
Research Areas:
5-heptyl-DNJ is a potent GAA agonist with a Ki of 0.0047 μM. 5-C-heptyl-DNJ increases GAA activities by chaperrone effects .
- 1
- 2
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
