From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
ODN 1018 (1018 ISS) is a TLR9 agonist and immune modulator. ODN 1018 exhibits adjuvant activity and augments CD8+ T cell responses with LNP-encapsulated OVA peptides. ODN 1018 triggers sustained suppression of allergic airway inflammation. ODN 1018 can be used for the research of allergic asthma and systemic lupus erythematosus .
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
Golodirsen (SRP-4053) is an antisense oligonucleotide of the phophorodiamidate morpholino oligomer (PMO). Golodirsen restores the reading frame of the Duchenne muscular dystrophy (DMD) gene by modifying the splicing process of the pre-mRNA, skipping exon 53. Golodirsen can restore the expression of the anti-myostatin protein. Golodirsen can be used for the research of duchenne muscular dystrophy (DMD) .
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
Emapticap pegol (NOX-E36) is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36). mNOX-E36 is a murine-specific analogue of NOX-E36, an anti-MCP-1 L-RNA aptamer that was previously shown to attenuate liver fibrosis in mice .
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
Ultevursen (QR-421a) is a splice-modulating antisense oligonucleotide targeting exon 13 of the USH2A gene, which restores the functional expression of Usherin protein by inducing exon skipping. Ultevursen binds to USH2A pre-mRNA and modulates the splicing process to specifically skip exon 13 carrying the pathogenic mutation c.2299delG, generating an in-frame transcript and a truncated yet functionally normal protein. Ultevursen exhibits concentration-dependent exon skipping activity in human cells and retinal organoid models, and restores Usherin expression and retinal function in zebrafish and gene-edited mouse models. Ultevursen can be used for related research on type 2 Usher syndrome and non-syndromic retinitis pigmentosa .
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1) mRNA .
Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis .
5-C-phenethyl-DNJ is a selective α-glucosidase GAA inhibitor, with its Ki value for rhGAA being 0.81 μM. 5-C-phenethyl-DNJ exhibits extremely high selectivity for GANAB, GBA1, and GBA2. 5-C-phenethyl-DNJ can be used for the study of Pompe disease .
ODN 24888 is an guanine-modified inhibitory oligonucleotides (INH-ODN), shows potent inhibition on TLR7/TLR9-mediated signaling. ODN 24888 impairs IFN-α level and NF-κB activation, inhibits IL-6 release. ODN 24888 involves in immune and inflammatory responses, can be used as a vaccine adjuvant .
Gaa Mouse Pre-designed siRNA Set A contains three designed siRNAs for Gaa gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.
GAA Human Pre-designed siRNA Set A contains three designed siRNAs for GAA gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
Gaa Rat Pre-designed siRNA Set A contains three designed siRNAs for Gaa gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.
N-4′-(p-Trifluoromethylphenyl)butyl-DAB (compound 5g) is an agonit of lysosomal acid α-glucosidase(GAA). N-4′-(p-Trifluoromethylphenyl)butyl-DAB increases intracellular GAA activities dose-dependently, in Pompe patient's fibroblasts with the M519V mutation .
GAA-4OH is a potent and irreversible dihydroceramide desaturase-1 (DES1) inhibitor with an IC50 of 0.6 μM and a Ki of 139.5 nM. GAA-4OH undergoes oxidation to form a reactive iminoquinone that covalently blocks DES1’s catalytic cavity, causing permanent enzyme inactivation. GAA-4OH modulates sphingolipid balance by reducing ceramide-to-dihydroceramide ratios in liver tissue. GAA-4OH improves liver steatosis, inflammation, fibrosis, and reduces pro-inflammatory and pro-fibrogenic gene expression. GAA-4OH can be used for the research of metabolic dysfunction-associated steatotic liver disease (MASLD) .
ODN 21595 is a Guanine-Modified TLR7 and TLR9 inhibitor. ODN 21595 inhibits the release of IFN-α and IL-6 with no cytotoxic. ODN 21595 reduces the expression of CD86 and HLA-DR. ODN 21595 has the potential for the research of systemic lupus erythematosus (SLE) .
5-C-phenethyl-DNJ hydrochloride is an orally active acid α-glucosidase(GAA) activator. 5-C-phenethyl-DNJ hydrochloride can increase GAA activity in various tissues, particularly in the diaphragm. 5-C-phenethyl-DNJ hydrochloride can be used for the research of metabolic disease, such as Pompe disease .
ODN 1018 (1018 ISS) is a TLR9 agonist and immune modulator. ODN 1018 exhibits adjuvant activity and augments CD8+ T cell responses with LNP-encapsulated OVA peptides. ODN 1018 triggers sustained suppression of allergic airway inflammation. ODN 1018 can be used for the research of allergic asthma and systemic lupus erythematosus .
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
Golodirsen (SRP-4053) is an antisense oligonucleotide of the phophorodiamidate morpholino oligomer (PMO). Golodirsen restores the reading frame of the Duchenne muscular dystrophy (DMD) gene by modifying the splicing process of the pre-mRNA, skipping exon 53. Golodirsen can restore the expression of the anti-myostatin protein. Golodirsen can be used for the research of duchenne muscular dystrophy (DMD) .
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
Emapticap pegol (NOX-E36) is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36). mNOX-E36 is a murine-specific analogue of NOX-E36, an anti-MCP-1 L-RNA aptamer that was previously shown to attenuate liver fibrosis in mice .
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
Ultevursen (QR-421a) is a splice-modulating antisense oligonucleotide targeting exon 13 of the USH2A gene, which restores the functional expression of Usherin protein by inducing exon skipping. Ultevursen binds to USH2A pre-mRNA and modulates the splicing process to specifically skip exon 13 carrying the pathogenic mutation c.2299delG, generating an in-frame transcript and a truncated yet functionally normal protein. Ultevursen exhibits concentration-dependent exon skipping activity in human cells and retinal organoid models, and restores Usherin expression and retinal function in zebrafish and gene-edited mouse models. Ultevursen can be used for related research on type 2 Usher syndrome and non-syndromic retinitis pigmentosa .
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1) mRNA .
Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis .
ODN 24888 is an guanine-modified inhibitory oligonucleotides (INH-ODN), shows potent inhibition on TLR7/TLR9-mediated signaling. ODN 24888 impairs IFN-α level and NF-κB activation, inhibits IL-6 release. ODN 24888 involves in immune and inflammatory responses, can be used as a vaccine adjuvant .
Gaa Mouse Pre-designed siRNA Set A contains three designed siRNAs for Gaa gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.
GAA Human Pre-designed siRNA Set A contains three designed siRNAs for GAA gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
Gaa Rat Pre-designed siRNA Set A contains three designed siRNAs for Gaa gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.
ODN 21595 is a Guanine-Modified TLR7 and TLR9 inhibitor. ODN 21595 inhibits the release of IFN-α and IL-6 with no cytotoxic. ODN 21595 reduces the expression of CD86 and HLA-DR. ODN 21595 has the potential for the research of systemic lupus erythematosus (SLE) .
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
MedchemExpress Validation 03
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
MedchemExpress Validation 04
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedchemExpress Validation
Western blot analysis of extracts from THP-1(lane 2(20μg), Jurkat (lane 3(20μg) and NIH3T3(lane 4(20μg) using FOXO1A (HY-P80132) Rabbit mAb. Proteins were transferred
to a PVDF membrane and blocked with 5% non-fat milk in TBST for 2 hour at room temperature. The primary antibody (1/1000) and Loading control antibody (Beta Actin, HY-P80438, 1/10000) was
used in 5% non-fat milk in TBST at 4°C overnight. Goat Anti-Mouse/Rabbit IgG-HRP Secondary Antibody (1/10000) was used for 1 hour at room temperature.
MedChemExpress values your privacy and your trust is important to us. We use cookies to enhance your website experience. Some cookies are necessary to run the website.
Privacy and Cookie Policy
