Copy Link Print Information

hsa-miR-639 antagomir

hsa-miR-639 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.

  • Molecular Weight:7722.07
  • Speicherung:

    Please store the product under the recommended conditions in the Certificate of Analysis.

  • hsa-miR-639 antagomir Chemical Structure
    hsa-miR-639 antagomir Chemical Structure
Größe
Preis
Verfügbarkeit
Menge
Amount: USD 0.00
Please select quantity
or
or

* Bitte wählen Sie Menge, bevor Sie Artikel hinzufügen.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of hsa-miR-639 antagomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Finden Sie Ihren Händler vor Ort Your local distributor: Hycultec GmbHHycultec
  • Biologische Aktivität
  • Chemical Information
  • Reinheit & Dokumentation
  • Help & FAQs
Top Publications Citing

Use of MCE Products
Keywords
MOQ
Minimum order quantity
100 mg

Angebot einholen Auf Lager

Other size
Angebot einholen
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Einloggen
Registrieren
Sign in to MedChemExpress
Neuen Account Registrieren

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • hsa-miR-639 antagomir Chemical Structure
    hsa-miR-639 antagomir Chemical Structure RNA, (ACAGCGCUCGCAACCGCAGCG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (ACAGCGCUCGCAACCGCAGCG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)