hsa-miR-33a-5p antagomir
Based on 2 publication(s) in Google Scholar
hsa-miR-33a-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.
- 분자량:7014.58
-
보관:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) hsa-miR-33a-5p antagomir
More
Biological Activity
Chemical Information
-
분자량 7014.58
-
선적
Room temperature in continental US; may vary elsewhere.
-
보관
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
GUGCAUUGUAGUUGCAUUGCA
-
Stem-loop ID
hsa-mir-33a
-
Stem-loop Sequence
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGUGCAUCACAG
-
Species
Human, Mouse, Rat, Aedes aegypti, Alligator mississippiensis, Anolis carolinensis, Anopheles gambiae, Bombyx mori, Bovine, Branchiostoma belcheri, Capitella teleta, Chrysemys picta, Columba livia, Culex quinquefasciatus, Dasypus novemcinctus, Dinoponera quadriceps, Gadus morhua, Guinea pig, Horse, Manduca sexta, Monodelphis domestica, Oreochromis niloticus, Pteropus alecto, Python bivittatus, Rabbit, Salmo salar, Triops cancriformis, Tupaia chinensis, Xenopus laevis
Publications (2)
-
Journal Impact Factor
-
Most Recent
-
Glia
Lysosomal cholesterol accumulation in aged astrocytes impairs cholesterol delivery to neurons and can be rescued by cannabinoids. [Abstract]2024 Oct;72(10):1746-1765. PMID: 38856177 -
순도&문서
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)