mmu-miR-378a-3p agomir
Based on 1 publication(s) in Google Scholar
mmu-miR-378a-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:14533.03
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) mmu-miR-378a-3p agomir
More
Biological Activity
Chemical Information
-
Molecular Weight 14533.03
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
ACUGGACUUGGAGUCAGAAGG
-
Stem-loop ID
mmu-mir-378a
-
Stem-loop Sequence
AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU
-
Species
Mouse, Rat, Horse, Pan troglodytes, Rhesus monkey
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
Tohoku J Exp Med
Functional Mechanism and Clinical Implications of MiR-378a-3p in Femoral Shaft Fracture Healing Processes. [Abstract]2025 Jun 5. PMID: 40467483
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)