miRNA agomirs

miRNA agomirs (4603):

Cat. No.	Product Name	CAS No.	Purity	Chemical Structure

HY-R00268A

hsa-miR-138-5p agomir
hsa-miR-138-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (AGCUGGUGUUGUGAAUCAGGCCG), complex with RNA, (GCCUGAUUCACAACACCAGCUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (AGCUGGUGUUGUGAAUCAGGCCG), complex with RNA, (GCCUGAUUCACAACACCAGCUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00003A

hsa-let-7a-5p agomir
hsa-let-7a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UGAGGUAGUAGGUUGUAUAGUU), complex with RNA, (CUAUACAACCUACUACCUCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UGAGGUAGUAGGUUGUAUAGUU), complex with RNA, (CUAUACAACCUACUACCUCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R03025A

mmu-miR-326-3p agomir
mmu-miR-326-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (CCUCUGGGCCCUUCCUCCAGU), complex with RNA, (UGGAGGAAGGGCCCAGAGGNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (CCUCUGGGCCCUUCCUCCAGU), complex with RNA, (UGGAGGAAGGGCCCAGAGGNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00202A

hsa-miR-128-3p agomir
hsa-miR-128-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UCACAGUGAACCGGUCUCUUU), complex with RNA, (AGAGACCGGUUCACUGUGANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UCACAGUGAACCGGUCUCUUU), complex with RNA, (AGAGACCGGUUCACUGUGANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00449A

hsa-miR-21-5p agomir
hsa-miR-21-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UAGCUUAUCAGACUGAUGUUGA), complex with RNA, (AACAUCAGUCUGAUAAGCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UAGCUUAUCAGACUGAUGUUGA), complex with RNA, (AACAUCAGUCUGAUAAGCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00287A

hsa-miR-146a-5p agomir
hsa-miR-146a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UGAGAACUGAAUUCCAUGGGUU), complex with RNA, (CCCAUGGAAUUCAGUUCUCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UGAGAACUGAAUUCCAUGGGUU), complex with RNA, (CCCAUGGAAUUCAGUUCUCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00559A

hsa-miR-3125 agomir
hsa-miR-3125 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UAGAGGAAGCUGUGGAGAGA), complex with RNA, (UCUCCACAGCUUCCUCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UAGAGGAAGCUGUGGAGAGA), complex with RNA, (UCUCCACAGCUUCCUCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R01185A

hsa-miR-4640-5p agomir
hsa-miR-4640-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UGGGCCAGGGAGCAGCUGGUGGG), complex with RNA, (CACCAGCUGCUCCCUGGCCCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UGGGCCAGGGAGCAGCUGGUGGG), complex with RNA, (CACCAGCUGCUCCCUGGCCCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R01514A

hsa-miR-503-5p agomir
hsa-miR-503-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UAGCAGCGGGAACAGUUCUGCAG), complex with RNA, (GCAGAACUGUUCCCGCUGCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UAGCAGCGGGAACAGUUCUGCAG), complex with RNA, (GCAGAACUGUUCCCGCUGCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R01973A

hsa-miR-655-3p agomir
hsa-miR-655-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (AUAAUACAUGGUUAACCUCUUU), complex with RNA, (AGAGGUUAACCAUGUAUUAUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (AUAAUACAUGGUUAACCUCUUU), complex with RNA, (AGAGGUUAACCAUGUAUUAUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R03076A

mmu-miR-34a-3p agomir
mmu-miR-34a-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (AAUCAGCAAGUAUACUGCCCU), complex with RNA, (GGCAGUAUACUUGCUGAUUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (AAUCAGCAAGUAUACUGCCCU), complex with RNA, (GGCAGUAUACUUGCUGAUUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R04602A

MicroRNA Agomir Negative Control

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

RNA, (UUGUACUACACAAAAGUACUG), complex with RNA, (GUACUUUUGUGUAGUACAANN) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
RNA, (UUGUACUACACAAAAGUACUG), complex with RNA, (GUACUUUUGUGUAGUACAANN) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

MicroRNA Agomir Negative Control
MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

HY-R00950A

hsa-miR-4271 agomir
hsa-miR-4271 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (GGGGGAAGAAAAGGUGGGG), complex with RNA, (CCACCUUUUCUUCCCCCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (GGGGGAAGAAAAGGUGGGG), complex with RNA, (CCACCUUUUCUUCCCCCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00505A

hsa-miR-296-3p agomir		98.51%
hsa-miR-296-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (GAGGGUUGGGUGGAGGCUCUCC), complex with RNA, (AGAGCCUCCACCCAACCCUCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (GAGGGUUGGGUGGAGGCUCUCC), complex with RNA, (AGAGCCUCCACCCAACCCUCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R02536A

hsa-miR-9-5p agomir
hsa-miR-9-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UCUUUGGUUAUCUAGCUGUAUGA), complex with RNA, (AUACAGCUAGAUAACCAAAGANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UCUUUGGUUAUCUAGCUGUAUGA), complex with RNA, (AUACAGCUAGAUAACCAAAGANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00714A

hsa-miR-34a-5p agomir		98.06%
hsa-miR-34a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UGGCAGUGUCUUAGCUGGUUGU), complex with RNA, (AACCAGCUAAGACACUGCCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UGGCAGUGUCUUAGCUGGUUGU), complex with RNA, (AACCAGCUAAGACACUGCCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R01101A

hsa-miR-4492 agomir
hsa-miR-4492 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (GGGGCUGGGCGCGCGCC), complex with RNA, (CGCGCGCCCAGCCCCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (GGGGCUGGGCGCGCGCC), complex with RNA, (CGCGCGCCCAGCCCCNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00511A

hsa-miR-29a-5p agomir
hsa-miR-29a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (ACUGAUUUCUUUUGGUGUUCAG), complex with RNA, (GAACACCAAAAGAAAUCAGUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (ACUGAUUUCUUUUGGUGUUCAG), complex with RNA, (GAACACCAAAAGAAAUCAGUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00540A

hsa-miR-30c-5p agomir
hsa-miR-30c-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UGUAAACAUCCUACACUCUCAGC), complex with RNA, (UGAGAGUGUAGGAUGUUUACANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UGUAAACAUCCUACACUCUCAGC), complex with RNA, (UGAGAGUGUAGGAUGUUUACANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

HY-R00495A

hsa-miR-26a-5p agomir
hsa-miR-26a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

RNA, (UUCAAGUAAUCCAGGAUAGGCU), complex with RNA, (CCUAUCCUGGAUUACUUGAANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) RNA, (UUCAAGUAAUCCAGGAUAGGCU), complex with RNA, (CCUAUCCUGGAUUACUUGAANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

Name
Email *

	Sorry, but the email address you supplied was invalid.