Copy Link Print Information

hsa-miR-375-3p agomir

hsa-miR-375-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Para uso exclusivo en investigación. No vendemos a pacientes.

  • Peso molecular:15196.46
  • Almacenamiento:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • hsa-miR-375-3p agomir Chemical Structure
    hsa-miR-375-3p agomir Chemical Structure
Tamaño
Precio
Stock
Cantidad
Amount: USD 0.00
Please select quantity
or
or

* Seleccione Cantidad antes de agregar artículos.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of hsa-miR-375-3p agomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Encuentre su distribuidor local Your local distributor: Hycultec GmbHHycultec
  • Actividad biológica
  • Chemical Information
  • Pureza y Documentación
  • Help & FAQs
Top Publications Citing

Use of MCE Products

Keywords

MOQ
Minimum order quantity
100 mg

Obtener un presupuesto En stock

Other size
Obtener un presupuesto
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Inicie sesiòn
Registrar
Sign in to MedChemExpress
Registrar una cuenta nueva

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • hsa-miR-375-3p agomir Chemical Structure
    hsa-miR-375-3p agomir Chemical Structure RNA, (UUUGUUCGUUCGGCUCGCGUGA), complex with RNA, (ACGCGAGCCGAACGAACAAANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (UUUGUUCGUUCGGCUCGCGUGA), complex with RNA, (ACGCGAGCCGAACGAACAAANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)