hsa-miR-93-5p agomir
Based on 1 publication(s) in Google Scholar
hsa-miR-93-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:15845.87
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Publications Citing Use of MedChemExpress (MCE) hsa-miR-93-5p agomir
More
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 15845.87
-
Color White to off-white
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
CAAAGUGCUGUUCGUGCAGGUAG
-
Stem-loop ID
hsa-mir-93
-
Stem-loop Sequence
CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACCCAACCUACUGCUGAGCUAGCACUUCCCGAGCCCCCGG
-
Species
Human, Mouse, Rat, Alligator mississippiensis, Callithrix jacchus, Cricetulus griseus, Dasypus novemcinctus, Daubentonia madagascariensis, Dog, Goat, Guinea pig, Horse, Nomascus leucogenys, Otolemur garnettii, Papio hamadryas, Pteropus alecto, Rabbit, Tupaia chinensis, Xenopus laevis
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
Int J Mol Sci
LRRC8A Inhibition Overcomes Chemoresistance by Downregulating MRP3 and CYP3A4 in the 3D Spheroid Model of Human Breast Cancer Cells. [Abstract]2026 Mar 13;27(6):2646. PMID: 41898509
Purity & Documentation
-
Data Sheet (230 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)