2. Search Result
Search Result
Results for "

messenger RNA

" in MedChemExpress (MCE) Product Catalog:

31

Inhibitors & Agonists

1

Fluorescent Dye

1

Biochemical Assay Reagents

1

Peptides

6

Natural
Products

3

Isotope-Labeled Compounds

16

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-P0063
    Copper tripeptide
    1 Publications Verification

    GHK-Cu

    		 Biochemical Assay Reagents Inflammation/Immunology
    Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .
    Copper tripeptide
  • HY-132609
    Patisiran sodium
    1 Publications Verification

    		 Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-112980
    Nusinersen
    4 Publications Verification

    		 DNA/RNA Synthesis Neurological Disease
    Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
    Nusinersen
  • HY-N0086
    N6-Methyladenosine
    Maximum Cited Publications
    7 Publications Verification

    6-Methyladenosine; N-Methyladenosine

    		 Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-112980A
    Nusinersen sodium
    4 Publications Verification

    		 DNA/RNA Synthesis Neurological Disease
    Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
    Nusinersen sodium
  • HY-151507
    306Oi10
    1 Publications Verification

    		 Liposome Others
    306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
    306Oi10
  • HY-132610A
    Givosiran sodium
    1 Publications Verification

    ALN-AS1 sodium

    		 Small Interfering RNA (siRNA) Metabolic Disease
    Givosiran (ALN-AS1) sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran sodium demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran sodium can be used for the research of acute hepatic porphyria (AHP) .
    Givosiran sodium
  • HY-132610
    Givosiran
    1 Publications Verification

    ALN-AS1

    		 Small Interfering RNA (siRNA) Metabolic Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran can be used for the research of acute hepatic porphyria (AHP) .
    Givosiran
  • HY-132587
    Fitusiran

    ALN-AT3SC; SAR439774

    		 Factor Xa Small Interfering RNA (siRNA) Thrombin Cardiovascular Disease
    Fitusiran (ALN-AT3SC) is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran can be used in hemophilia-related research .
    Fitusiran
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-W416291
    Polyadenylic acid potassium

    Poly(A)

    		 Biochemical Assay Reagents Cancer
    Polyadenylic acid potassium, also known as Poly(A), is enzymatically added to messenger RNA (mRNA) in eukaryotic cells to stabilize mRNAs. Poly(A) is used to evaluate binding on cationic liposomes doped with non-ionic nucleolipids. Poly(A) is used in small molecule mRNA targeted drug development to evaluate the binding of potential therapeutic agents such as the Isoquinoline group of alkaloids. Small molecules that could bind to this poly(A) tail could influence and possibly inhibit mRNA function and subsequent protein production in the cell leading to the development of new type of therapeutic agents.
    Polyadenylic acid potassium
  • HY-153492A
    Olpasiran sodium

    AMG 890 sodium; ARC-LPA sodium

    		 Small Interfering RNA (siRNA) Inflammation/Immunology
    Olpasiran (AMG 890, ARC-LPA) sodium is an N-acetyl galactosamine (GalNAc)-conjugated, hepatocyte-targeted siRNA. Olpasiran sodium directly inhibits LPA messenger RNA translation in hepatocytes and potently reduce Lp(a) concentration. Olpasiran sodium can be used for the research of cardiovascular disease, such as atherosclerosis .
    Olpasiran sodium
  • HY-N6606
    Delphinidin-3-O-galactoside chloride
    1 Publications Verification

    		 Glycosidase Tyrosinase Heme Oxygenase (HO) HSP Metabolic Disease Inflammation/Immunology
    Delphinidin-3-O-galactoside chloride is an anthocyanin found in abbiteye blueberry. Delphinidin-3-O-galactoside chloride show inhibitory activitiesagainst α-glucosidase with an IC50 of 68.33 μM, and tyrosinase with an IC50 of 34.14 μM. Delphinidin-3-O-galactoside chloride attenuates HO-1 and HSP70 messenger RNA down-regulation, suppresses cytotoxicity, reduces endoplasmic reticulum stress responses, scavenges free radicals, reduces intracellular triglyceride levels and lipid droplet accumulation. Delphinidin-3-O-galactoside chloride can be used for the researches of diabesity, melanoma and inflammation .
    Delphinidin-3-O-galactoside chloride
  • HY-132587A
    Fitusiran sodium

    ALN-AT3SC sodium; SAR439774 sodium

    		 Factor Xa Small Interfering RNA (siRNA) Thrombin Cardiovascular Disease
    Fitusiran (ALN-AT3SC) sodium is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran sodium enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran sodium can be used in hemophilia-related research .
    Fitusiran sodium
  • HY-150224
    GalNAc unconjugated/naked Fitusiran sodium

    		Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-114208A
    BI-9321 trihydrochloride

    		Histone Methyltransferase Cancer
    BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321 trihydrochloride
  • HY-153609
    AS-Patisiran sodium

    		Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-N0086S
    N6-Methyladenosine-d3

    6-Methyladenosine-d3; N-Methyladenosine-d3

    		 Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-d3
  • HY-N0086R
    N6-Methyladenosine (Standard)
    1 Publications Verification

    6-Methyladenosine (Standard); N-Methyladenosine (Standard)

    		 Endogenous Metabolite Influenza Virus Reference Standards Infection
    N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities. In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .
    N6-Methyladenosine (Standard)
  • HY-153238
    AN15368

    		Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
    AN15368
  • HY-N0086S2
    N6-Methyladenosine-13C4

    6-Methyladenosine-13C4; N-Methyladenosine-13C4

    		 Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-13C4
  • HY-114208
    BI-9321

    		Histone Methyltransferase Cancer
    BI-9321, a chemical probe, is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321
  • HY-156985
    Lipid AX4

    		Isotope-Labeled Compounds Liposome Others
    Lipid AX4 is an ionizable cationic lipid with the pKa of 6.89， and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .
    Lipid AX4
  • HY-P0063A
    Copper tripeptide acetate

    GHK-Cu acetate

    		 Biochemical Assay Reagents Inflammation/Immunology
    Copper tripeptide (GHK-Cu) acetate is a tripeptide. During wound healing, Copper tripeptide acetate may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide acetate has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide acetate is a natural modulator of multiple cllular pathways in skin regeneration .
    Copper tripeptide acetate
  • HY-174792
    Cre-T2A-GFP mRNA

    		mRNA Others
    The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP).
    Cre-T2A-GFP mRNA
  • HY-N0086S3
    N6-Methyladenosine-13C3

    6-Methyladenosine-13C3; N-Methyladenosine-13C3

    		 Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C3 (6-Methyladenosine- 13C3) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .
    N6-Methyladenosine-13C3
  • HY-N6606R
    Delphinidin-3-O-galactoside chloride (Standard)

    		Reference Standards Glycosidase Tyrosinase Heme Oxygenase (HO) HSP Metabolic Disease Inflammation/Immunology
    Delphinidin-3-O-galactoside chloride (Standard) is the analytical standard of Delphinidin-3-O-galactoside chloride (HY-N6606). This product is intended for research and analytical applications. Delphinidin-3-O-galactoside chloride is an anthocyanin found in abbiteye blueberry. Delphinidin-3-O-galactoside chloride show inhibitory activitiesagainst α-glucosidase with an IC50 of 68.33 μM, and tyrosinase with an IC50 of 34.14 μM. Delphinidin-3-O-galactoside chloride attenuates HO-1 and HSP70 messenger RNA down-regulation, suppresses cytotoxicity, reduces endoplasmic reticulum stress responses, scavenges free radicals, reduces intracellular triglyceride levels and lipid droplet accumulation. Delphinidin-3-O-galactoside chloride can be used for the researches of diabesity, melanoma and inflammation .
    Delphinidin-3-O-galactoside chloride (Standard)
  • HY-174791
    Cre-T2A-GFP mRNA (N1-Methylpseudo-UTP)

    		mRNA Others
    The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP). The incorporation of N1-Methylpseudo-UTP can reduce the immunogenicity of the resulting mRNA.
    Cre-T2A-GFP mRNA (N1-Methylpseudo-UTP)
  • HY-D3416
    TMR-DN

    TAMRA-2,4-dinitroaniline

    		 Fluorescent Dye Others
    TMR-DN (TAMRA-2,4-dinitroaniline) is a bright orange fluorescent probe that binds to the SRB-2 aptamer, with a Kd value of 35 nM for the SRB-2 aptamer. TMR-DN exhibits low background fluorescence, enabling wash-free live-cell RNA imaging .
    TMR-DN
  • HY-N19830
    Guavenoic acid

    		Reactive Oxygen Species (ROS) Apoptosis Cancer
    Guavenoic acid is a triterpenoid compound that can be isolated from fresh leaves of Psidium guajava. Guavenoic acid protects cells in cellular oxidative damage models, inhibits intracellular ROS production, and suppresses cell apoptosis. Guavenoic acid significantly enhances cellular proliferation, promotes insulin synthesis and secretion, and upregulates the messenger RNA expression of insulin gene, PDX-1 and MafA. Guavenoic acid can be used in the research of diseases such as pancreatic islet β-cell tumors .
    Guavenoic acid

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: