Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
29 Results for "
messenger RNA
" in MedChemExpress (MCE) Product Catalog:
Products (29)
29 Results for "messenger RNA" in MCE Product Catalog:
8
8 Publications Verification
Synonyms: 6-Methyladenosine; N-Methyladenosine
Target:
6
6 Cited Publications
Target:
Research Areas:
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
6
6 Cited Publications
Cat. No.: HY-112980A
Purity: 98.91%
Target:
Research Areas:
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
2
2 Cited Publications
Synonyms: 6-Methyladenosine (Standard); N-Methyladenosine (Standard)
1
Target:
1
1 Cited Publications
Research Areas:
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
1
1 Cited Publications
1
Target:
Research Areas:
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran can be used for the research of acute hepatic porphyria (AHP) .
1
1 Cited Publications
Synonyms: ALN-AS1 sodium
Target:
Research Areas:
Givosiran (ALN-AS1) sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran sodium demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran sodium can be used for the research of acute hepatic porphyria (AHP) .
1
1 Cited Publications
Cat. No.: HY-N6606
CAS No.: 28500-00-7
Synonyms: ALN-AT3SC; SAR439774
Research Areas:
Fitusiran (ALN-AT3SC) is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran can be used in hemophilia-related research .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-153492A
Purity: 98.82%
Synonyms: AMG 890 sodium; ARC-LPA sodium
Target:
Research Areas:
Olpasiran (AMG 890, ARC-LPA) sodium is an N-acetyl galactosamine (GalNAc)-conjugated, hepatocyte-targeted siRNA. Olpasiran sodium directly inhibits LPA messenger RNA translation in hepatocytes and potently reduce Lp(a) concentration. Olpasiran sodium can be used for the research of cardiovascular disease, such as atherosclerosis .
Cat. No.: HY-132587A
Purity: 94.68%
Synonyms: ALN-AT3SC sodium; SAR439774 sodium
Research Areas:
Fitusiran (ALN-AT3SC) sodium is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran sodium enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran sodium can be used in hemophilia-related research .
Cat. No.: HY-150224
Purity: 97.93%
Research Areas:
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
Research Areas:
BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
Cat. No.: HY-153609
Purity: 92.51%
Research Areas:
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
Cat. No.: HY-N0086S
CAS No.: 139896-43-8
Synonyms: 6-Methyladenosine-d3; N-Methyladenosine-d3
Cat. No.: HY-N0086S2
Synonyms: 6-Methyladenosine-13C4; N-Methyladenosine-13C4
- 1
- 2
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
