1. Search Result
Search Result
Results for "

RNA targets

" in MedChemExpress (MCE) Product Catalog:

198

Inhibitors & Agonists

9

Screening Libraries

4

Fluorescent Dyes

3

Biochemical Assay Reagents

10

Peptides

3

MCE Kits

13

Natural
Products

1

Isotope-Labeled Compounds

2

Click Chemistry

61

Oligonucleotides

1

GMP Molecules

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-B0438
    Spectinomycin dihydrochloride
    3 Publications Verification

    Bacterial Antibiotic Infection
    Spectinomycin dihydrochloride is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM - .
    Spectinomycin dihydrochloride
  • HY-132609
    Patisiran sodium
    1 Publications Verification

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-D0971
    Pyronin Y
    4 Publications Verification

    Pyronine G; C.I. 45005

    DNA Stain Others
    Pyronin Y (Pyronine G) is a cationic dye that intercalates RNA and has been used to target cell structures including RNA, DNA and organelles. Pyronin Y forms fluorescent complexes with double-stranded nucleic acids (especially RNA) enabling semi-quantitative analysis of cellular RNA. Pyronin Y can be used to identify specific RNA subspecies of ribonuclear proteins complexes in live cells .
    Pyronin Y
  • HY-15176A
    Pyridostatin hydrochloride
    Maximum Cited Publications
    34 Publications Verification

    RR82 hydrochloride

    DNA/RNA Synthesis G-quadruplex Flavivirus Src Virus Protease Cancer
    Pyridostatin (RR82) hydrochloride is a G-quadruplex DNA stabilizing agent (Kd=490 nM) and can target DNA and RNA G4s in cells. Pyridostatin hydrochloride promotes growth arrest in human cancer cells by inducing replication- and transcription-dependent DNA damage. Pyridostatin hydrochloride targets the proto-oncogene Src. Pyridostatin hydrochloride reduced SRC protein levels and SRC-dependent cellular motility in human breast cancer cells .
    Pyridostatin hydrochloride
  • HY-15176

    RR82

    G-quadruplex Cancer
    Pyridostatin (RR82) is a G-quadruplex DNA stabilizing agent (Kd=490 nM) and can target DNA and RNA G4s in cells. Pyridostatin promotes growth arrest in human cancer cells by inducing replication- and transcription-dependent DNA damage. Pyridostatin targets the proto-oncogene Src. Pyridostatin reduced SRC protein levels and SRC-dependent cellular motility in human breast cancer cells .
    Pyridostatin
  • HY-B1828A

    Spectinomycin hydrochloride hydrate

    Bacterial Antibiotic Infection
    Spectinomycin dihydrochloride pentahydrate is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride pentahydrate acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride pentahydrate is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM - .
    Spectinomycin dihydrochloride pentahydrate
  • HY-145586

    ZSP1273

    Influenza Virus DNA/RNA Synthesis Infection
    Onradivir (ZSP1273) is an orally active antiviral agent targeting influenza A virus RNA polymerase PB2 subunit with an IC50 of 0.562 nM. Onradivir inhibits cap binding to influenza A virus RNA polymerase PB2 subunit, suppresses viral replication, reduces viral titres and RNA loads, and inhibits influenza A virus infection. Onradivir maintains high survival rates in influenza A virus-infected mice, and reduces influenza A virus titers in a murine model. Onradivir can be used for the research of influenza A virus infection .
    Onradivir
  • HY-132610A
    Givosiran sodium
    1 Publications Verification

    ALN-AS1 sodium

    Small Interfering RNA (siRNA) Metabolic Disease
    Givosiran (ALN-AS1) sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran sodium demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran sodium can be used for the research of acute hepatic porphyria (AHP) .
    Givosiran sodium
  • HY-132610
    Givosiran
    1 Publications Verification

    ALN-AS1

    Small Interfering RNA (siRNA) Metabolic Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran can be used for the research of acute hepatic porphyria (AHP) .
    Givosiran
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-148904

    Amine N-methyltransferase Others
    Allylic-SAM is an S-adenosyl methionine (SAM) analog. Allylic-SAM can be for the enrichment and detection of methyltransferase target sites in RNA .
    Allylic-SAM
  • HY-150223
    GalNAc unconjugated/naked Inclisiran
    1 Publications Verification

    PCSK9 Small Interfering RNA (siRNA) Cardiovascular Disease
    GalNAc unconjugated/naked Inclisiran is a double-stranded small interfering RNA molecule that targets hepatic PCSK9 production to reduce LDL-C levels. GalNAc unconjugated/naked Inclisiran can be used in the research of cardiovascular diseases and hypercholesterolemia .
    GalNAc unconjugated/naked Inclisiran
  • HY-132608

    ISIS-420915 sodium

    Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
    Inotersen sodium
  • HY-W009444
    5-Methyluridine
    1 Publications Verification

    Endogenous Metabolite Others
    5-Methyluridine (m 5U) is an RNA modified nucleotide generated by RNA methyltransferases (such as TrmA and RumA), which mainly targets specific uracil sites in RNA molecules such as the T arm of tRNA and rRNA. 5-Methyluridine relies on enzyme recognition of RNA secondary/tertiary structures (such as the T loop of tRNA or the specific stem-loop structure of rRNA) and participates in physiological processes such as translation accuracy and ribosome function by stabilizing RNA folding or regulating base pairing .
    5-Methyluridine
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-132606A

    DCR-PHXC sodium

    Small Interfering RNA (siRNA) Lactate Dehydrogenase Metabolic Disease
    Nedosiran (DCR-PHXC) sodium is an RNA interference (RNAi) targeting lactate dehydrogenase (LDH). Nedosiran sodium represents an impactful potential therapeutic for primary hyperoxaluria (PH) with end-stage renal disease (ESRD). Nedosiran sodium is a GalNAc-dsRNA conjugate .
    Nedosiran sodium
  • HY-132613

    Small Interfering RNA (siRNA) Glycolate Oxidase Metabolic Disease
    Lumasiran sodium, an investigational RNA interference (RNAi) therapeutic agent, reduces hepatic oxalate production by targeting glycolate oxidase. Lumasiran sodium reduces urinary oxalate excretion, the cause of progressive kidney failure in primary hyperoxaluria type 1 (PH1) .
    Lumasiran sodium
  • HY-14776
    Quarfloxin
    5+ Cited Publications

    CX-3543

    DNA/RNA Synthesis Cancer
    Quarfloxin (CX-3543), a fluoroquinolone derivative with antineoplastic activity, targets and inhibits RNA pol I activity, with IC50 values in the nanomolar range in neuroblastoma cells. Quarfloxin disrupts the interaction between the nucleolin protein and a G-quadruplex DNA structure in the ribosomal DNA (rDNA) template .
    Quarfloxin
  • HY-147425

    SLN360

    Small Interfering RNA (siRNA) Apolipoprotein Cardiovascular Disease
    Zerlasiran (SLN360) is a siRNA targeting apolipoprotein A (ApoA). Zerlasiran targets hepatic ApoA synthesis via RNA interference to degrade encoding mRNA. Zerlasiran can be used for the research of atherosclerotic cardiovascular disease and elevated ApoA levels .
    Zerlasiran
  • HY-113138
    3-Methyluridine
    1 Publications Verification

    N3-Methyluridine

    Endogenous Metabolite Metabolic Disease
    3-Methyluridine (m 3U; N3-Methyluridine) is a methylated nucleotide present in ribosomal RNA (rRNA), mainly targeting specific base sites of RNA molecules such as 23S rRNA. 3-Methyluridine can introduce a methyl group at the N3 position of uracil, affecting the secondary structure stability and base pairing ability of RNA, and regulating ribosome function. For example, it affects ribosomal subunit binding and tRNA interaction. 3-Methyluridine is often used as a key raw material for the synthesis of modified nucleotides, and is used to construct RNA oligonucleotides containing methylation modifications to study the effects of RNA methylation on gene expression and drug resistance .
    3-Methyluridine
  • HY-B1828

    Antibiotic Bacterial Infection
    Spectinomycin is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin is also a noncompetitive inhibitor of td intron RNA .
    Spectinomycin
  • HY-150014

    Others Others
    AMT-NHS is an RNA-protein crosslinker. AMT-NHS is composed of a psoralen derivative and an N-hydroxysuccinimide ester group which react with RNA bases and primary amines of protein, respectively. AMT-NHS can penetrate into living yeast cells and crosslink Cbf5 to H/ACA snoRNAs with high specificity. AMT-NHS induces different crosslinking patterns and targets both single- and double-stranded regions of RNA. AMT-NHS can be used for capturing diverse RNA-protein interactions in cells .
    AMT-NHS
  • HY-147425A

    SLN360 sodium

    Small Interfering RNA (siRNA) Apolipoprotein Cardiovascular Disease Metabolic Disease
    Zerlasiran (SLN360) sodium is a siRNA targeting apolipoprotein A (ApoA). Zerlasiran sodium targets hepatic ApoA synthesis via RNA interference to degrade encoding mRNA. Zerlasiran sodium can be used for the research of atherosclerotic cardiovascular disease and elevated ApoA levels .
    Zerlasiran sodium
  • HY-132589A
    Vutrisiran sodium
    2 Publications Verification

    ALN-TTRsc02 sodium

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Vutrisiran sodium (ALN-TTRsc02 sodium) is a liver-directed small interfering RNA (siRNA). Vutrisiran sodium targets the mRNA of transthyretin (TTR), and is applicable to studies on transthyretin (TTR)-mediated amyloidosis .
    Vutrisiran sodium
  • HY-145072

    CDK Cancer
    BSJ-01-175 is a potent and selective CDK12/13 covalent inhibitor. BSJ-01-175 demonstrates exquisite selectivity, potent inhibition of RNA polymerase II phosphorylation, and downregulation of CDK12-targeted genes in cancer cells .
    BSJ-01-175
  • HY-148688

    DNA/RNA Synthesis Others
    ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
    ASO 556089 sodium
  • HY-139682

    RIBOTAC DNA/RNA Synthesis PPAR Programmed Cell Death 4 (PDCD4) Cancer
    Dovitinib RIBOTAC is an RNA-targeting RIBOTAC degrader that can specifically bind to and degrade pre-miR-21. Dovitinib RIBOTAC can inhibit the metastasis of breast cancer and has anti-tumor activity .
    Dovitinib-RIBOTAC
  • HY-145638A

    RO7445482 sodium

    HBV Infection
    Xalnesiran (RO7445482) sodium is a small interfering RNA molecule that targets a conserved region of the
    hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
    Xalnesiran sodium
  • HY-75800
    Lomibuvir
    2 Publications Verification

    VX-222

    DNA/RNA Synthesis HCV Infection
    Lomibuvir (VX-222), a selective, non-nucleoside polymerase inhibitor, targets thumb pocket 2 of the HCV NS5B polymerase (RdRp) with a Kd of 17 nM. Lomibuvir inhibits the 1b/Con1 HCV subgenomic replicon with an EC50 of 5.2 nM. Lomibuvir preferentially inhibits elongative RNA synthesis rather than de novo-initiated RNA synthesis .
    Lomibuvir
  • HY-175324

    Molecular Glues HuR Cancer
    MG-HuR2 is a molecular glue degrader targeting the oncogenic RNA-binding protein HuR (IC50=0.5 μM). MG-HuR2 is promising for research of HuR-overexpressing malignancies (e.g., breast cancer) .
    MG-HuR2
  • HY-153492A

    AMG 890 sodium; ARC-LPA sodium

    Small Interfering RNA (siRNA) Inflammation/Immunology
    Olpasiran (AMG 890, ARC-LPA) sodium is an N-acetyl galactosamine (GalNAc)-conjugated, hepatocyte-targeted siRNA. Olpasiran sodium directly inhibits LPA messenger RNA translation in hepatocytes and potently reduce Lp(a) concentration. Olpasiran sodium can be used for the research of cardiovascular disease, such as atherosclerosis .
    Olpasiran sodium
  • HY-153108

    ARCA cap solution (100 mM)

    DNA/RNA Synthesis Others
    3'-O-Me-m7G(5')ppp(5')A (ARCA cap) solution (100 mM), anti-reverse cap analog, has a special RNA cap structure. 3'-O-Me-m7G(5')ppp(5')A solution (100 mM) improves mRNA translation efficiency and stability, reduces translational inhibition by proteins such as IFIT1, and enables stronger and longer-lasting expression of the target protein. The RNA cap structure is a common feature of mRNAs in some RNA viruses and eukaryotes, and it serves as a signal for translation initiation .
    3'-O-Me-m7G(5')ppp(5')A solution (100 mM)
  • HY-149648

    RSV DNA/RNA Synthesis Infection
    JNJ-8003 is a potent and orally active non-nucleoside RSV polymerase inhibitor with an IC50 of 0.29 nM. JNJ-8003 targets the L protein polymerase complex of RSV (IC50 = 0.67 nM), and blocks the transcription and replication of the viral genome by inhibiting the activity of RNA-dependent RNA polymerase (RdRp). JNJ-8003 displays subnanomolar activity in vitro as well as prominent efficacy in mice and a neonatal lamb models. JNJ-8003 can be used for the study of respiratory syncytial virus (RSV) .
    JNJ-8003
  • HY-W048488

    DNA/RNA Synthesis Drug Intermediate Others
    2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
    2'-O-MOE-5-Me-rU
  • HY-150224

    Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-153609

    Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-157604

    DNA/RNA Synthesis Cancer
    DHX9-IN-9 (509) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.0177 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-9
  • HY-132590A

    ALN-TTRSC sodium

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Revusiran (ALN-TTRSC) sodium is an RNA interference agent targeting the mRNA of transthyretin (Transthyretin, TTR). Revusiran sodium mediates sequence-specific degradation of TTR mRNA through RNA interference, reduces the synthesis of TTR protein, binds to GalNAc ligands, and is taken up by hepatocytes via the asialoglycoprotein receptor. Revusiran sodium exhibits favorable nonclinical safety profiles. Revusiran sodium can be used in studies related to transthyretin-mediated amyloidosis .
    Revusiran sodium
  • HY-132607A

    CEBPA-51 sodium

    MicroRNA Inflammation/Immunology Cancer
    MTL-CEBPA (sodium) is the sodium form of MTL-CEBPA (HY-132607). MTL-CEBPA (sodium) is a small activating RNA targeting for upregulation of C/EBPα. MTL-CEBPA (sodium) has anti-inflammatory and anti-cancer activity .
    MTL-CEBPA sodium
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-175397

    DFHBI-thalidomide

    PROTACs NF-κB Early 2 Factor (E2F) Bcl-2 Family VEGFR Cancer
    Dth (DFHBI-thalidomide) is an RNA aptamer-based PROTAC degrader. Dth can degrade a variety of endogenous proteins (such as mCherry, p50, p65 and E2F1) by replacing the 3′ module on the RNA scaffold with the RNA aptamer corresponding to the target protein. Dth upregulates IκB-α and Bax, and downregulates Bcl-2 and VEGF. Dth generates green fluorescence upon binding to the Broccoli RNA aptamer, enabling the tracing of RNA scaffolds. Dth can be used in cancer-related research .
    Dth
  • HY-132606

    DCR-PHXC

    Small Interfering RNA (siRNA) Lactate Dehydrogenase Metabolic Disease
    Nedosiran (DCR-PHXC) is an RNA interference (RNAi) targeting lactate dehydrogenase (LDH). Nedosiran represents an impactful potential therapeutic for primary hyperoxaluria (PH) with end-stage renal disease (ESRD). Nedosiran is a GalNAc-dsRNA conjugate .
    Nedosiran
  • HY-15843

    MicroRNA Apoptosis Cancer
    MIR96-IN-1 targets the Drosha site in the miR-96 (miRNA-96, microRNA-96) hairpin precursor, inhibiting its biogenesis, derepressing downstream targets, and triggering apoptosis in breast cancer cells. MIR96-IN-1 binds to RNAs with Kds of 1.3, 9.4, 3.4, 1.3 and 7.4 μM for RNA1, RNA2, RNA3, RNA4 and RNA5, respectively . MIR96-IN-1 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
    MIR96-IN-1
  • HY-139682A

    RIBOTAC Programmed Cell Death 4 (PDCD4) DNA/RNA Synthesis PPAR Cancer
    Dovitinib RIBOTAC TFA is an RNA-targeting RIBOTAC degrader that can specifically bind to and degrade pre-miR-21. Dovitinib RIBOTAC TFA can inhibit the metastasis of breast cancer and has anti-tumor activity .
    Dovitinib-RIBOTAC TFA
  • HY-153483

    SYL040012

    Adrenergic Receptor Small Interfering RNA (siRNA) Others
    Bamosiran is a small interfering RNA targeting β-adrenergic receptor 2, and is used to lower intraocular pressure
    Bamosiran
  • HY-132607

    CEBPA-51

    MicroRNA Inflammation/Immunology Cancer
    MTL-CEPBA is a small activating RNA targeting for upregulation of C/EBPα. MTL-CEPBA has anti-inflammatory and anti-cancer activity .
    MTL-CEBPA
  • HY-145638

    RO7445482

    HBV Infection
    Xalnesiran (RO7445482) is a small interfering RNA molecule that targets a conserved region of the
    hepatitis B virus (HBV) genome. Xalnesiran can be used for the research of chronic hepatitis B infection .
    Xalnesiran
  • HY-132590

    ALN-TTRSC

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Revusiran (ALN-TTRSC) is an RNA interference agent targeting the mRNA of transthyretin (Transthyretin, TTR). Revusiran mediates sequence-specific degradation of TTR mRNA through RNA interference, reduces the synthesis of TTR protein, binds to GalNAc ligands, and is taken up by hepatocytes via the asialoglycoprotein receptor. Revusiran exhibits favorable nonclinical safety profiles. Revusiran can be used in studies related to transthyretin-mediated amyloidosis .
    Revusiran
  • HY-W115309

    5'-DMT-2'-F-ibu-dG

    Phosphoramidites Nucleoside Antimetabolite/Analog Others
    DMT-2'-F-iBu-G (5'-DMT-2'-F-ibu-dG) is a modified oligonucleotide. 2'-deoxy-2'-fluoro-modified oligonucleotides shows high nuclease resistant and retained exceptional binding affinity to the RNA targets .
    DMT-2'-F-iBu-G
  • HY-P2548

    EGFR Others
    pp60 (v-SRC) Autophosphorylation Site, Phosphorylated is the phosphorylated peptide of an EGFR substrate. pp60 (v-SRC) Autophosphorylation Site, Phosphorylated can be used for the screening of EGFR Kinase inhibitors via phosphorylated-substrate quantification .
    pp60 (v-SRC) Autophosphorylation Site, Phosphorylated

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: