Search Result

No matches for "

curine

" within the MedChemExpress (MCE) catalog. Here are the results you might be looking for.

By Targets:	Apoptosis (2) Biochemical Assay Reagents (9) Cadherin (1) CaMK (2) CDK (2) DNA/RNA Synthesis (7) Drug Intermediate (1) Endogenous Metabolite (7) Epigenetic Reader Domain (1) Fluorescent Dye (2) Isotope-Labeled Compounds (1) MMP (2) Nucleoside Antimetabolite/Analog (13) Parasite (2) PARP (1) Phosphoramidites (2) Protease Activated Receptor (PAR) (1) Reference Standards (4) STAT (1) Tau Protein (2) Thrombin (1) VEGFR (1)
By Research Areas:	Cancer (16) Cardiovascular Disease (6) Endocrinology (2) Infection (3) Inflammation/Immunology (3) Metabolic Disease (7) Neurological Disease (6)
Click Chemistry:	BCN (1) Alkynes (1)
Oligonucleotides:	Nucleoside Analogs (10) Adenine (1) Inosine (1) Hypoxanthine (1) Phosphoramidites (2) Antisense Oligonucleotides (4)

Inhibitors & Agonists

Biochemical Assay Reagents

Peptides

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-W010128

6-(Dimethylamino)purine 6-Dimethylaminopurine; 6-DMAP	CDK DNA/RNA Synthesis Apoptosis	Cancer
6-(Dimethylamino) purine (6-Dimethylaminopurine) is a serine threonine protein kinase inhibitor. 6-(Dimethylamino) purine can inhibit prolactin induced expression of lactoprotein genes in rabbit mammary gland cells. 6-(Dimethylamino) purine can affect the maturation of mammalian oocytes. 6-(Dimethylamino) purine can lead to downregulation of genes related to cell proliferation and cell cycle progression, such as proliferating cell nuclear antigen, insulin-like gene 1, and serine protease inhibitor 2 genes, and induce apoptosis in lymphoma cells (apoptosis) .

HY-34431

*Purine* 7H-Imidazo(4,5-d)pyrimidine	Endogenous Metabolite PARP	Neurological Disease Metabolic Disease Cancer
Purine is an endogenous metabolite. Purine bases are the building blocks of the nucleic acids. Purine inhibits the activation of PARP. Purine protects against oxidant-induced cell injury. Purine can be used in the research of cancer and nervous system diseases .

HY-114164G

Murine Thrombin	Thrombin Protease Activated Receptor (PAR) MMP VEGFR Epigenetic Reader Domain	Cardiovascular Disease Neurological Disease Inflammation/Immunology
Murine Thrombin is a murine serine protease that plays a central role in blood coagulation. Murine Thrombin stimulates macrophages to polarize into a unique phenotype characterized by anti-inflammatory and pro-repair properties. Murine Thrombin activates PAR1, induces the production of MCP-1, MMP3 and VEGF in mouse intervertebral discs, and causes degradation of the cartilage matrix and destruction of intervertebral disc structure. Murine Thrombin activity increases significantly in paraoxon-induced status epilepticus .

HY-125864B

Murine Fibrinogen	MMP Cadherin	Cardiovascular Disease Neurological Disease
Murine Fibrinogen is a native fibrinogen derived from mouse plasma. Murine Fibrinogen acts as a cerebrovascular permeability enhancer. Murine Fibrinogen activates matrix metalloproteinase-9 (MMP-9), downregulates the expression of vascular endothelial cadherin (VE-cadherin), and upregulates the expression of plasmalemmal vesicle-associated protein-1 (PV-1). Murine Fibrinogen increases macromolecular leakage from pial veins, thereby disrupting the microvascular integrity of cerebral blood vessels. Murine Fibrinogen can be used in studies related to cerebrovascular dysfunction .

HY-P2975

*Laminin (Engelbreth-Holm-Swarm murine* sarcoma basement membrane)** Mouse laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)	Endogenous Metabolite Biochemical Assay Reagents	Neurological Disease
Laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.

HY-NP143

*Nerve Growth Factor 2.5S,murine* submaxillary gland**	Biochemical Assay Reagents	Neurological Disease
Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .

HY-P2724

Purine nucleoside phosphorylase, Microorganism PNP	Endogenous Metabolite	Metabolic Disease
Purine nucleoside phosphorylase, Microorganism (PNP) is a key enzyme in purine metabolism, which is involved in the purine rescue pathway. The deficiency of Purine nucleoside phosphorylase resulted in impaired T cell function. In the presence of inorganic orthophosphate as the second substrate, Purine nucleoside phosphorylase catalyzes the breaking of the glycosidic bond between ribose and deoxyribonucleoside to generate purine base and ribose (deoxyribose) -1-phosphate .

HY-132582A

*Tau ASO-12 (murine) sodium*	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-W097453

6-(Methylthio)purine 2 Publications Verification 6-Methylmercaptopurine	Endogenous Metabolite	Others
6-(Methylthio)purine (6-Methylmercaptopurine) is a small molecule that can be used for compound synthesis .

HY-W013631

*7H-Purine-2,6-diamine*	Biochemical Assay Reagents	Others
7H-Purine-2,6-diamine is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-154516

2-Chloro-9-(beta-D-ribofuranosyl)purine	Nucleoside Antimetabolite/Analog	Cancer
2-Chloro-9-(beta-D-ribofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-Y0247

6-Chloropurine 6-Chloro-9H-purine	Drug Intermediate	Cancer
6-Chloropurine is a building block in chemical synthesis. Intermediate in the preparation of 9-alkylpurines and 6-rnercaptopurine. Antitumor activities .

HY-NP144

*Nerve Growth Factor 7S,murine* submaxillary gland**	Biochemical Assay Reagents	Neurological Disease
Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .

HY-P2728A

Murine Antithrombin III	Biochemical Assay Reagents	Cardiovascular Disease
Murine Antithrombin III is a blood coagulation inhibitory enzyme with high catalytic efficiency, high specificity, mild action conditions, etc., and can be used in the pharmaceutical industry, industrial production, food manufacturing, aquaculture and other industries .

HY-152808

6-(2-Furanyl)-9-β-D-ribofuranosyl-9H-purine	Nucleoside Antimetabolite/Analog	Others
6-(2-Furanyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-P2821B

Murine Plasminogen	Biochemical Assay Reagents	Cardiovascular Disease
Murine Plasminogen is purified from freshly collected murine plasma and is an inactive precursor of the protease plasmin. It is activated to the serine protease plasmin by urokinase, streptokinase, or tissue plasminogen activator.

HY-137658

Purine riboside triphosphate PTP	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis CaMK	Metabolic Disease
Purine riboside-5'-O-triphosphate, an active metabolite of Nebularine (HY-103694), acts as an inhibitor of DNA primase ATP and GTP polymerization activities, with IC₅₀ values of 35 µM and 28 µM for the human enzyme, respectively. Purine riboside-5'-O-triphosphate also inhibits calmodulin-dependent protein kinase II (CaMKII) with a K_i value of 590 µM .

HY-W002924

6-Chloro-2-fluoro-9H-purine	Biochemical Assay Reagents	Others
6-Chloro-2-fluoro-9H-purine is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-P2724A

Purine nucleoside phosphorylase, Bacillus sp. PNP, Bacillus sp.	Endogenous Metabolite	Metabolic Disease
Purine nucleoside phosphorylase, Bacillus sp. is a key enzyme in purine metabolism, involved in the purine salvage pathway. A deficiency in Purine nucleoside phosphorylase, Bacillus sp. can lead to impaired T-cell function. In the presence of inorganic phosphate as a second substrate, Purine nucleoside phosphorylase, Bacillus sp. catalyzes the cleavage of the glycosidic bond of ribonucleosides and deoxyribonucleosides, producing purine bases and ribose (or deoxyribose)-1-phosphate. Purine nucleoside phosphorylase, Bacillus sp. can be used for the determination of inorganic phosphate .

HY-E70547A

Murine Factor XIII	Biochemical Assay Reagents	Cardiovascular Disease
Murine Factor XIII is a natural coagulation factor present in plasma, composed of two identical α subunits and two identical β subunits .

HY-144296

Purine phosphoribosyltransferase-IN-2	Parasite	Infection
Purine phosphoribosyltransferase-IN-2 is a potent inhibitor of the Plasmodium falciparum ((Pf)), Plasmodium vivax ((Pv)) and Trypanosoma brucei ((Tbr)) 6-oxopurine phosphoribosyltransferase (PRT), with K_is of 30, 20 and 2 nM, respectively .

HY-144294

Purine phosphoribosyltransferase-IN-1	Parasite	Infection
Purine phosphoribosyltransferase-IN-1 (Compound (S,R)-48) is a potent inhibitor of the Plasmodium falciparum (Pf), P. vivax (Pv) and Trypanosoma brucei (Tbr) 6-oxopurine purine phosphoribosyltransferases (PRTs), with K_i values of 50, 20, and 2 nM, respectively .

HY-E70085

*Moloney murine* leukemia virus RT**	DNA/RNA Synthesis	Infection
Moloney murine leukemia virus RT is a monomeric reverse transcriptase from Moloney murine leukemia virus (MMLV). Moloney murine leukemia virus RT is a replicative polymerase that play an essential role in the life cycle of the retrovirus .

HY-137658A

Purine riboside-5'-O-triphosphate sodium PTP tetrasodium	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis CaMK	Metabolic Disease
Purine riboside-5'-O-triphosphate sodium, an active metabolite of Nebularine (HY-103694), acts as an inhibitor of DNA primase ATP and GTP polymerization activities, with IC₅₀ values of 35 µM and 28 µM for the human enzyme, respectively. Purine riboside-5'-O-triphosphate sodium inhibits calmodulin-dependent protein kinase II (CaMKII) with a K_i value of 590 µM .

HY-152494

6-Methyl-9-(β-D-xylofuranosyl)purine	Nucleoside Antimetabolite/Analog	Cancer
6-Methyl-9-(β-D-xylofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-150667S

*2-Amino-6-(3-methoxy-anilino)purine-d3* N6-(3-Methoxy-d3-phenyl)-7H-purine-2,6-diamine	Isotope-Labeled Compounds	Others
2-Amino-6-(3-methoxy-anilino)purine-d₃ is the deuterium labeled 2-Amino-6-(3-methoxy-anilino)purine .

HY-131847

*2,6-Dichloro-2',3',5'-triacetyl-purine* riboside** 2,6-Dichloro-9-(2’,3’,5’-tri-O-acetyl-β-D-ribofuranosyl)purine	Nucleoside Antimetabolite/Analog	Cancer
2,6-Dichloro-2',3',5'-triacetyl-purine riboside is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-154251

2-Methoxy-9-β-D-ribofuranosyl-9H-purine	Nucleoside Antimetabolite/Analog	Cancer
2-Methoxy-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152805

9-(2-β-C-Methyl-β-D-ribofuranosyl)purine	Nucleoside Antimetabolite/Analog	Others
9-(2-β-C-Methyl-β-D-ribofuranosyl)purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-W010128R

*6-(Dimethylamino)purine* (Standard)** 6-Dimethylaminopurine (Standard); 6-DMAP (Standard)	Reference Standards CDK DNA/RNA Synthesis Apoptosis	Cancer
6-(Dimethylamino) purine (6-Dimethylaminopurine) is a serine threonine protein kinase inhibitor. 6-(Dimethylamino) purine can inhibit prolactin induced expression of lactoprotein genes in rabbit mammary gland cells. 6-(Dimethylamino) purine can affect the maturation of mammalian oocytes. 6-(Dimethylamino) purine can lead to downregulation of genes related to cell proliferation and cell cycle progression, such as proliferating cell nuclear antigen, insulin-like gene 1, and serine protease inhibitor 2 genes, and induce apoptosis in lymphoma cells (apoptosis) .

HY-152660

*2-Amino-6-O-methyl-2’-O-methyl purine* riboside**	Nucleoside Antimetabolite/Analog	Cancer
2-Amino-6-O-methyl-2’-O-methyl purine riboside is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-34431R

Purine (Standard) 7H-Imidazo(4,5-d)pyrimidine (Standard)	Reference Standards Endogenous Metabolite	Metabolic Disease
Purine (Standard) is the analytical standard of Purine. This product is intended for research and analytical applications. Purine is an endogenous metabolite.

HY-152655

6-Ethoxy-9-beta-D-(2-C-methyl-ribofuranosyl)purine	Nucleoside Antimetabolite/Analog	Cancer
6-Ethoxy-9-beta-D-(2-C-methyl-ribofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152663

6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine	Nucleoside Antimetabolite/Analog	Cancer
6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-152579

6-(1-Piperazinyl)-9-β-D-ribofuranosyl-9H-purine	Nucleoside Antimetabolite/Analog	Others
6-(1-Piperazinyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152572

6-(4-Morpholinyl)-9-β-D-ribofuranosyl-9H-purine	Nucleoside Antimetabolite/Analog	Others
6-(4-Morpholinyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-135849H

Catalase, Murine	Biochemical Assay Reagents	Metabolic Disease
Catalase, Murine (EC 1.11.1.6) activates the decomposition of hydrogen peroxide, a reactive oxygen species, into water and oxygen. Catalase functions as a natural antioxidant, protecting cells against oxidative damage to proteins, lipids and nucleic acids.

HY-182123

*2'-DeoxyNebularine-CE phosphoramidite (Purine)*	DNA/RNA Synthesis Phosphoramidites	Others
2'-DeoxyNebularine-CE phosphoramidite (Purine) is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-132582H

*FAM labled Tau ASO-12 (murine) sodium*	Fluorescent Dye	Cancer
FAM labled Tau ASO-12 (murine) sodiumis a FAM labled Tau ASO-12 (murine) sodium.

HY-W579409

*2'-OMe-6-Cl-Purine-CE phosphoramidite*	DNA/RNA Synthesis Phosphoramidites	Others
(2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(6-chloro-9H-purin-9-yl)-4-methoxytetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-132582E

*Tau ASO-12 (murine) sodium scrambled negative control*	Tau Protein	Cancer
Tau ASO-12 (murine) sodium scrambled negative control is the sequence scrambled negative control of Tau ASO-12 (murine) sodium.

HY-132582I

*Cy3 labled Tau ASO-12 (murine) sodium*	Fluorescent Dye	Cancer
Cy3 labled Tau ASO-12 (murine) sodium is a Cy3 labled Tau ASO-12 (murine) sodium.

HY-W097453R

*6-(Methylthio)purine* (Standard)** 6-Methylmercaptopurine (Standard)	Endogenous Metabolite Reference Standards	Others
6-(Methylthio)purine (6-Methylmercaptopurine) is a small molecule that can be used for compound synthesis .

HY-W129440R

*N6-Cyclopropyl-9H-purine-2,6-diamine (Standard)*	Reference Standards
N6-Cyclopropyl-9H-purine-2,6-diamine (Standard) is the analytical standard of N6-Cyclopropyl-9H-purine-2,6-diamine. This product is intended for research and analytical applications.

HY-183628

MEAP 2-(4-Morpholinoanilino-6-[(2-exo-norbornyl) amino)-purine	STAT	Endocrinology Cancer
MEAP (2-(4-Morpholinoanilino-6-[(2-exo-norbornyl) amino)-purine) is a NEDD9-STAT3 modulator. MEAP disrupts NEDD9-STAT3 interaction, driving STAT3 Y705 dephosphorylation. MEAP induces G₂/M phase arrest. MEAP can be used for the research of anaplastic thyroid cancer .

Cat. No.	Product Name	Type

HY-P2975

Laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)

Mouse laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)

Biochemical Assay Reagents

Laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.

HY-NP143

*Nerve Growth Factor 2.5S,murine* submaxillary gland**	Biochemical Assay Reagents
Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .

HY-W013631

*7H-Purine-2,6-diamine*	Biochemical Assay Reagents
7H-Purine-2,6-diamine is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-NP144

*Nerve Growth Factor 7S,murine* submaxillary gland**	Biochemical Assay Reagents
Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .

HY-W002924

6-Chloro-2-fluoro-9H-purine	Biochemical Assay Reagents
6-Chloro-2-fluoro-9H-purine is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

Cat. No.	Product Name	Target	Research Area

HY-P11206A

Murine cardiac troponin I peptide TFA Murine cardiac TnI peptide TFA	Peptides	Inflammation/Immunology
Murine cardiac troponin I peptide (Murine cardiac TnI peptide) TFA is a murine cardiac troponin I (cTnI) peptide. Murine cardiac troponin I peptide TFA can induce significant myocardial inflammation followed by fibrosis and heart failure with increased mortality in mice model. Murine cardiac troponin I peptide TFA can be used for heart failure research .

HY-P11206

Murine cardiac troponin I peptide Murine cardiac TnI peptide	Peptides	Cardiovascular Disease Inflammation/Immunology
Murine cardiac troponin I peptide (Murine cardiac TnI peptide) is a murine cardiac troponin I (cTnI) peptide. Murine cardiac troponin I peptide can induce significant myocardial inflammation followed by fibrosis and heart failure with increased mortality in mice model. Murine cardiac troponin I peptide can be used for heart failure research .

HY-P11738

Murine ZP3 peptide (330-342)	Peptides	Endocrinology
Murine ZP3 peptide (330-342) is a zona pellucida 3 polypeptide fragment with the amino acid sequence NSSSSQFQIHGPR. Murine ZP3 peptide (330-342) induces autoimmune premature ovarian failure (POF). Murine ZP3 peptide (330-342) can be used for the research of premature ovarian failure .

Tag:	His (1) Tag Free (1)
Source:	E. coli (2)

Cat. No.	Compare	Product Name	Species	Source	Image

HY-P701869

	Purine nucleoside phosphorylase Protein, Thermus thermophilus Purine nucleoside phosphorylase	Others	E. coli
	Purine nucleoside phosphorylase Protein, Thermus thermophilus is the recombinant Purine nucleoside phosphorylase protein, expressed by E. coli, with tag free.

HY-P701870

	Purine nucleoside phosphorylase Protein, Thermus thermophilus (His) Purine nucleoside phosphorylase	Others	E. coli
	Purine nucleoside phosphorylase Protein, Thermus thermophilus (His) is the recombinant Purine nucleoside phosphorylase protein, expressed by E. coli, with N-6*His labeled tag.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-152663

6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine		Alkynes
6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-183628

MEAP 2-(4-Morpholinoanilino-6-[(2-exo-norbornyl) amino)-purine		BCN
MEAP (2-(4-Morpholinoanilino-6-[(2-exo-norbornyl) amino)-purine) is a NEDD9-STAT3 modulator. MEAP disrupts NEDD9-STAT3 interaction, driving STAT3 Y705 dephosphorylation. MEAP induces G₂/M phase arrest. MEAP can be used for the research of anaplastic thyroid cancer .

Cat. No.	Product Name		Classification

HY-132582A

*Tau ASO-12 (murine) sodium*		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-154516

2-Chloro-9-(beta-D-ribofuranosyl)purine		Nucleoside Analogs
2-Chloro-9-(beta-D-ribofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152808

6-(2-Furanyl)-9-β-D-ribofuranosyl-9H-purine		Nucleoside Analogs
6-(2-Furanyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152494

6-Methyl-9-(β-D-xylofuranosyl)purine		Nucleoside Analogs
6-Methyl-9-(β-D-xylofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-154251

2-Methoxy-9-β-D-ribofuranosyl-9H-purine		Nucleoside Analogs
2-Methoxy-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152805

9-(2-β-C-Methyl-β-D-ribofuranosyl)purine		Nucleoside Analogs
9-(2-β-C-Methyl-β-D-ribofuranosyl)purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152660

*2-Amino-6-O-methyl-2’-O-methyl purine* riboside**		Nucleoside Analogs
2-Amino-6-O-methyl-2’-O-methyl purine riboside is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152655

6-Ethoxy-9-beta-D-(2-C-methyl-ribofuranosyl)purine		Nucleoside Analogs Inosine
6-Ethoxy-9-beta-D-(2-C-methyl-ribofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152663

6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine		Nucleoside Analogs
6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 6-Mthoxy-9-beta-D-(2-C-ethynyl-ribofuranosyl) purine is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-152579

6-(1-Piperazinyl)-9-β-D-ribofuranosyl-9H-purine		Nucleoside Analogs
6-(1-Piperazinyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152572

6-(4-Morpholinyl)-9-β-D-ribofuranosyl-9H-purine		Nucleoside Analogs
6-(4-Morpholinyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-182123

*2'-DeoxyNebularine-CE phosphoramidite (Purine)*		Phosphoramidites Adenine
2'-DeoxyNebularine-CE phosphoramidite (Purine) is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-132582H

*FAM labled Tau ASO-12 (murine) sodium*		Antisense Oligonucleotides
FAM labled Tau ASO-12 (murine) sodiumis a FAM labled Tau ASO-12 (murine) sodium.

HY-W579409

*2'-OMe-6-Cl-Purine-CE phosphoramidite*		Phosphoramidites Hypoxanthine
(2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(6-chloro-9H-purin-9-yl)-4-methoxytetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-132582E

*Tau ASO-12 (murine) sodium scrambled negative control*		Antisense Oligonucleotides
Tau ASO-12 (murine) sodium scrambled negative control is the sequence scrambled negative control of Tau ASO-12 (murine) sodium.

HY-132582I

*Cy3 labled Tau ASO-12 (murine) sodium*		Antisense Oligonucleotides
Cy3 labled Tau ASO-12 (murine) sodium is a Cy3 labled Tau ASO-12 (murine) sodium.

Inquiry Online

Submit your filled information, we will contact you soon.

Salutation:		* Country or Region:
* Applicant Name:		* Organization Name:
* Department:
* Email Address:		* Product Name:
Cat. No.:		* Requested quantity:
* Phone Number:
MCE Japan Authorized Agent:	ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Remarks:

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

curine

Inhibitors & Agonists

Biochemical Assay Reagents

Peptides

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Inquiry Online

Natural
Products