Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
50 Results for "
curine
" in MedChemExpress (MCE) Product Catalog:
Products (50)
50 Results for "curine" in MCE Product Catalog:
2
Target:
Research Areas:
6-(Methylthio)purine (6-Methylmercaptopurine) is a small molecule that can be used for compound synthesis .
1
1 Cited Publications
Cat. No.: HY-P2975
CAS No.: 114956-81-9
Synonyms: Mouse laminin (Engelbreth-Holm-Swarm murine sarcoma basement membrane)
Cat. No.: HY-W010128
CAS No.: 938-55-6
Synonyms: 6-Dimethylaminopurine; 6-DMAP
Category:
Target:
Category:
Natural Products Microorganisms Metabolic Disease Endogenous metabolite Disease Research Fields
Target:
Cat. No.: HY-114164G
CAS No.: 9002-04-4
Research Areas:
Cardiovascular Disease Neurological Disease Inflammation/Immunology
Murine Thrombin is a murine serine protease that plays a central role in blood coagulation. Murine Thrombin stimulates macrophages to polarize into a unique phenotype characterized by anti-inflammatory and pro-repair properties. Murine Thrombin activates PAR1, induces the production of MCP-1, MMP3 and VEGF in mouse intervertebral discs, and causes degradation of the cartilage matrix and destruction of intervertebral disc structure. Murine Thrombin activity increases significantly in paraoxon-induced status epilepticus .
Cat. No.: HY-125864B
CAS No.: 9001-32-5
Research Areas:
Murine Fibrinogen is a native fibrinogen derived from mouse plasma. Murine Fibrinogen acts as a cerebrovascular permeability enhancer. Murine Fibrinogen activates matrix metalloproteinase-9 (MMP-9), downregulates the expression of vascular endothelial cadherin (VE-cadherin), and upregulates the expression of plasmalemmal vesicle-associated protein-1 (PV-1). Murine Fibrinogen increases macromolecular leakage from pial veins, thereby disrupting the microvascular integrity of cerebral blood vessels. Murine Fibrinogen can be used in studies related to cerebrovascular dysfunction .
Cat. No.: HY-NP143
CAS No.: 93928-24-6
Target:
Research Areas:
Purine nucleoside phosphorylase, Microorganism (PNP) is a key enzyme in purine metabolism, which is involved in the purine rescue pathway. The deficiency of Purine nucleoside phosphorylase resulted in impaired T cell function. In the presence of inorganic orthophosphate as the second substrate, Purine nucleoside phosphorylase catalyzes the breaking of the glycosidic bond between ribose and deoxyribonucleoside to generate purine base and ribose (deoxyribose) -1-phosphate .
Cat. No.: HY-132582A
Purity: 94.68%
Target:
Research Areas:
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Cat. No.: HY-W013631
CAS No.: 1904-98-9
Target:
Research Areas:
2-Chloro-9-(beta-D-ribofuranosyl)purine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
Target:
Research Areas:
6-Chloropurine is a building block in chemical synthesis. Intermediate in the preparation of 9-alkylpurines and 6-rnercaptopurine. Antitumor activities .
Cat. No.: HY-NP144
CAS No.: 93928-24-6
Cat. No.: HY-P11206A
Synonyms: Murine cardiac TnI peptide TFA
Target:
Research Areas:
Cat. No.: HY-P2728A
Target:
Research Areas:
Murine Antithrombin III is a blood coagulation inhibitory enzyme with high catalytic efficiency, high specificity, mild action conditions, etc., and can be used in the pharmaceutical industry, industrial production, food manufacturing, aquaculture and other industries .
Cat. No.: HY-152808
CAS No.: 352025-81-1
Target:
Research Areas:
6-(2-Furanyl)-9-β-D-ribofuranosyl-9H-purine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
Cat. No.: HY-P11206
Synonyms: Murine cardiac TnI peptide
Target:
Research Areas:
Target:
Research Areas:
Murine Plasminogen is purified from freshly collected murine plasma and is an inactive precursor of the protease plasmin. It is activated to the serine protease plasmin by urokinase, streptokinase, or tissue plasminogen activator.
Cat. No.: HY-137658
CAS No.: 23197-96-8
Synonyms: PTP
Research Areas:
Purine riboside-5'-O-triphosphate, an active metabolite of Nebularine (HY-103694), acts as an inhibitor of DNA primase ATP and GTP polymerization activities, with IC50 values of 35 µM and 28 µM for the human enzyme, respectively. Purine riboside-5'-O-triphosphate also inhibits calmodulin-dependent protein kinase II (CaMKII) with a Ki value of 590 µM .
Cat. No.: HY-P11738
CAS No.: 152439-29-7
Target:
Research Areas:
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
