hsa-miR-145-5p antagomir
Based on 2 publication(s) in Google Scholar
hsa-miR-145-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:7829.09
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Publications Citing Use of MedChemExpress (MCE) hsa-miR-145-5p antagomir
More
Biological Activity
Chemical Information
-
Appearance Solid
-
Molecular Weight 7829.09
-
Color White to off-white
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
GUCCAGUUUUCCCAGGAAUCCCU
-
Stem-loop ID
hsa-mir-145
-
Stem-loop Sequence
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU
-
Species
Human, Mouse, Rat, Bovine, Callithrix jacchus, Chrysemys picta, Columba livia, Daubentonia madagascariensis, Dog, Gadus morhua, Goat, Guinea pig, Horse, Ictalurus punctatus, Microcebus murinus, Monodelphis domestica, Nomascus leucogenys, Oreochromis niloticus, Otolemur garnettii, Pan paniscus, Papio hamadryas, Petromyzon marinus, Pteropus alecto, Python bivittatus, Rabbit, Salmo salar
Publications (2)
-
Journal Impact Factor
-
Most Recent
-
J Extracell Vesicles
Extracellular Vesicles From Mesenchymal Stromal Cells Drive Muscle and Neuronal Regeneration Through TNFα Modulation. [Abstract]2026 Mar;15(3):e70237. PMID: 41811203 -
Adv Sci (Weinh)
Circular RNA PTPN4 Contributes to Blood-Brain Barrier Disruption during Early Epileptogenesis. [Abstract]2025 Dec 14:e02250. PMID: 41391036
Purity & Documentation
-
Data Sheet (231 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)