1. Epigenetics
  2. MicroRNA
  3. hsa-miR-371b-3p antagomir

hsa-miR-371b-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Para uso exclusivo en investigación. No vendemos a pacientes.

RNA, (GCACUCAAACUGUGGGGGCAC) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-371b-3p antagomir Estructura química

Tamaño Precio Stock Cantidad
5 nmol Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* Seleccione Cantidad antes de agregar artículos.

This product is a controlled substance and not for sale in your territory.

Revisión del cliente

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-371b-3p antagomir:

Top Publications Citing Use of Products
  • Actividad biológica

  • Pureza y Documentación

  • Revisión del cliente

Descripciòn

hsa-miR-371b-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Peso molecular

7764.06

miRBase Accession Number
Mature miRNA Sequence

AAGUGCCCCCACAGUUUGAGUGC

Stem-loop ID

hsa-mir-371b

Stem-loop Sequence

GGUAACACUCAAAAGAUGGCGGCACUUUCACCAGAGAGCAGAAAGUGCCCCCACAGUUUGAGUGCC

Species

Human

Envío

Room temperature in continental US; may vary elsewhere.

Almacenamiento

Please store the product under the recommended conditions in the Certificate of Analysis.

Pureza y Documentación
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Calculadora de molaridad

  • Calculadora de dilución

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Productos vistos recientemente:

Consulta en línea

Your information is safe with us. * Required Fields.

Nombre del producto

 

Requested Quantity *

Nombre del solicitante *

 

Saludo

Direcciòn del E-mail *

 

Número de teléfono *

Department

 

Nombre de la Organizaciòn *

City

Provincia

Country or Region *

     

Observaciones

Consulta para venta a granel

Inquiry Information

Nombre del producto:
hsa-miR-371b-3p antagomir
Cat. No.:
HY-RI00822A
Cantidad:
MCE Japan Authorized Agent: