Copy Link Print Information

hsa-miR-497-5p agomir

1 Cited Publications
Customer Review

Based on 1 publication(s) in Google Scholar

hsa-miR-497-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

  • Molecular Weight:14509.01
  • Storage:

    Please store the product under the recommended conditions in the Certificate of Analysis.

  • hsa-miR-497-5p agomir Chemical Structure
    hsa-miR-497-5p agomir Chemical Structure
Size
Price
Stock
Quantity
Amount: USD 0.00
Please select quantity
or
or

* Please select Quantity before adding items.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of hsa-miR-497-5p agomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Find Your Local Distributor Your local distributor: Hycultec GmbHHycultec
  • Biological Activity
  • Chemical Information
  • Purity & Documentation
  • Help & FAQs
Top Publications Citing

Use of MCE Products

Publications Citing Use of MedChemExpress (MCE) hsa-miR-497-5p agomir

More

Keywords

MOQ
Minimum order quantity
100 mg

Get Quote In-stock

Other size
Get Quote
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Sign In
Register
Sign in to MedChemExpress
Register New Account

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • hsa-miR-497-5p agomir Chemical Structure
    hsa-miR-497-5p agomir Chemical Structure RNA, (CAGCAGCACACUGUGGUUUGU), complex with RNA, (AAACCACAGUGUGCUGCUGNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (CAGCAGCACACUGUGGUUUGU), complex with RNA, (AAACCACAGUGUGCUGCUGNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)