mmu-miR-223-5p antagomir
mmu-miR-223-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:7637.99
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 7637.99
-
Color White to off-white
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
CGUGUAUUUGACAAGCUGAGUUG
-
Stem-loop ID
mmu-mir-223
-
Stem-loop Sequence
UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG
-
Species
Mouse, Rat, Dasypus novemcinctus, Guinea pig, Ornithorhynchus anatinus, Rabbit
Purity & Documentation
-
Data Sheet (230 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)