2. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA oligonucleotides

" in MedChemExpress (MCE) Product Catalog:

69

Inhibitors & Agonists

13

Fluorescent Dyes

7

Biochemical Assay Reagents

2

Peptides

1

MCE Kits

1

Isotope-Labeled Compounds

4

Click Chemistry

32

Oligonucleotides

1

GMP Molecules

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-112754A
    DOTAP chloride
    Maximum Cited Publications
    14 Publications Verification

    1,2-Dioleoyl-3-trimethylammonium-propane chloride

    		 Liposome Cancer
    DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
    DOTAP chloride
  • HY-150751
    ODN TTAGGG
    3 Publications Verification

    ODN A151

    		 Toll-like Receptor (TLR) AIM2 Pyroptosis Interleukin Related Inflammation/Immunology
    ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
    ODN TTAGGG
  • HY-D0150
    Thiazole Orange
    1 Publications Verification

    		 Fluorescent Dye Others
    Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λex = 510 nm (488 nm and 470 nm also show strong excitation) and λem = 527 nm, respectively .
    Thiazole Orange
  • HY-D0093
    Ethidium homodimer
    4 Publications Verification

    EthD-1

    		 DNA Stain Others
    Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
    Ethidium homodimer
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-158712
    3'-ONH2-dATP sodium solution (100 mM)

    		Nucleoside Antimetabolite/Analog Others
    3'-ONH2-dATP sodium solution (100mM) is a 3'-O-blocked reversible terminator deoxynucleotide triphosphate. 3'-ONH2-dATP sodium solution (100mM) stops DNA polymerization after single-nucleotide addition to an initiator strand, and its 3'-ONH2 blocking group can be removed to restore a free 3'-OH for subsequent extension .
    3'-ONH2-dATP sodium solution (100 mM)
  • HY-160225
    ISD sodium
    4 Publications Verification

    		 STING Interleukin Related Inflammation/Immunology
    ISD sodium is an interferon-stimulatory DNA, a 45 bp non-CpG double-stranded oligonucleotide derived from the genome of Listeria monocytogenes. ISD sodium potently induces type I interferon production via the cGAS‑STING‑TBK1‑IRF3 pathway .
    ISD sodium
  • HY-152854
    5-(Hydroxymethyl)cytidine

    		Nucleoside Antimetabolite/Analog Cancer
    5-(Hydroxymethyl)cytidine is a purine nucleoside analog that can be used in oligonucleotide synthesis. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
    5-(Hydroxymethyl)cytidine
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-D0723
    5(6)-TAMRA SE
    3 Publications Verification

    5(6)-Carboxytetramethylrhodamine N-succinimidyl ester

    		 Fluorescent Dye Cancer
    5(6)-TAMRA SE is a fluorescent dye that emits red fluorescence. 5(6)-TAMRA SE binds to oligonucleotides and is used in DNA sequencing. 5(6)-TAMRA SE can be used in cancer research (Ex/Em = 565/580 nm) .
    5(6)-TAMRA SE
  • HY-138577
    2'-F-Bz-dC Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
    2'-F-Bz-dC Phosphoramidite
  • HY-W039442
    2′-Deoxy-2′-fluoroadenosine
    1 Publications Verification

    		 Nucleoside Antimetabolite/Analog Infection Cancer
    2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
    2′-Deoxy-2′-fluoroadenosine
  • HY-15939
    6-FAM SE

    		Fluorescent Dye Metabolic Disease
    6-FAM SE (6-carboxyfluorescein succinimidyl ester) is a fluorescent labeling reagent. 6-FAM SE is used for oligonucleotide labeling and DNA sequencing .
    6-FAM SE
  • HY-D1668
    Biotin-11-dCTP

    		DNA Stain Reverse Transcriptase Infection Neurological Disease Cancer
    Biotin-11-dCTP is a biotinylated deoxynucleoside triphosphate and an important DNA labeling reagent. In random primer DNA labeling reactions, Biotin-11-dCTP incorporates into newly synthesized DNA strands to generate labeled DNA probes suitable for hybridization applications. In addition, Biotin-11-dCTP can serve as a substrate for terminal deoxynucleotidyl transferase to end-label oligonucleotides for telomere sequence detection, or to label the cut ends of linearized DNA molecules, thereby supporting streptavidin-based electron microscopy analysis. For example, Biotin-11-dCTP can label the cut ends of linearized DNA molecules under the action of dGTP and avian myeloblastosis virus reverse transcriptase .
    Biotin-11-dCTP
  • HY-150751C
    ODN TTAGGG sodium
    3 Publications Verification

    ODN A151 sodium

    		 AIM2 Toll-like Receptor (TLR) Inflammation/Immunology
    ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
    ODN TTAGGG sodium
  • HY-W008849
    DMT-dC(bz) Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Others
    DMT-dC (bz) Phosphoramidite is a protected deoxycytidine phosphoramidite monomer, as well as a building block for mechanochemical DNA synthesis. DMT-dC (bz) Phosphoramidite serves as a reagent for oligonucleotide synthesis .
    DMT-dC(bz) Phosphoramidite
  • HY-D1090
    ​JOE

    		DNA Stain Fluorescent Dye Others
    JOE is a xanthene fluorophore (i.e., 4′,5′-dichloro-2′,7′-dimethoxy-5 (6)-carboxyfluorescein; 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein) with an absorption wavelength of approximately 525 nm and an emission wavelength of approximately 550 nm. The fluorescence quantum yield of JOE correlates with the rigidity of the linker arm and the distance to dG nucleoside. JOE is commonly used as a fluorescent label for oligonucleotides and molecular beacon probes, and also serves as the acceptor fluorophore in fluorescence energy transfer primers for DNA sequencing .
    ​JOE
  • HY-138155
    NSC15520

    		DNA/RNA Synthesis Cancer
    NSC15520 is a small molecular inhibitor of Replication Protein A (RPA). NSC15520 specifically recognizes the RPA N-terminal DNA binding domain (DBD), and blocks the interaction of RPA with p53 or RAD9. NSC15520 also inhibtis helix destabilization of a duplex DNA (dsDNA) oligonucleotide, involves in DNA replication, DNA repair, DNA recombination, and DNA damage response signaling .
    NSC15520
  • HY-46317
    DMT-5Me-dC(Bz)-CE Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Metabolic Disease
    DMT-5Me-dC(Bz)-CE Phosphoramidite is a chemical structural unit that can be used in solid-phase DNA synthesis. DMT-5Me-dC(Bz)-CE Phosphoramidite can introduce the 5-methylcytidine base into the DNA chain to enhance its stability and binding affinity. DMT-5Me-dC(Bz)-CE Phosphoramidite can be used to construct modified oligonucleotides, especially for constructing locked nucleic acids (LNA) .
    DMT-5Me-dC(Bz)-CE Phosphoramidite
  • HY-112754AGL
    DOTAP chloride (GMP Like)

    1,2-Dioleoyl-3-trimethylammonium-propane chloride (GMP Like)

    		 Liposome Others
    DOTAP chloride (GMP Like) is the GMP Like class DOTAP chloride (HY-112754A). GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. DOTAP chloride is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride (GMP Like) can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .
    DOTAP chloride (GMP Like)
  • HY-160222
    HSV-60mer sodium

    		HSV STING IFNAR NF-κB Infection
    HSV-60mer sodium is a 60 bp double-stranded DNA oligonucleotide derived from the HSV-1 genome, and also an IFNβ inducer. HSV-60mer sodium colocalizes with endogenous cytoplasmic IFI16 in immune cells. HSV-60mer sodium activates the transcription factors IRF3 and NF-κB, induces the production of proinflammatory cytokines, and inhibits HSV-1 replication in immune cells. HSV-60mer sodium can be used in studies related to herpes simplex virus type 1 infection .
    HSV-60mer sodium
  • HY-173193
    S-cEt-U phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Others
    S-cEt-U phosphoramidite is a modified phosphoramidite monomer that can be used for the oligonucleotide synthesis .
    S-cEt-U phosphoramidite
  • HY-W570887
    LNA-A(Bz) amidite

    		Phosphoramidites DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-160224
    dsVACV-70mer sodium

    		STING IFNAR Inflammation/Immunology
    dsVACV-70mer (sodium) is a 70 bp double-stranded oligonucleotide containing viral DNA motifs derived from vaccinia virus DNA. dsVACV-70mer (sodium) has potently induces IFN-β via a STING-dependent manner .
    dsVACV-70mer sodium
  • HY-W570888
    2'-O,4'-C-Methylenecytidine

    LNA-C(Bz)

    		 Nucleoside Antimetabolite/Analog Cancer
    2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
    2'-O,4'-C-Methylenecytidine
  • HY-W112938
    TMPyP tetrachloride

    		DNA Alkylator/Crosslinker Photosensitizer Infection Cancer
    TMPyP tetrachloride is a DNA-binding agent, singlet oxygen Sensitizer and photobleaching agent. TMPyP tetrachloride binds to DNA via intercalation or external groove complexation; irradiation induces its photoinduced release from DNA. TMPyP tetrachloride sensitizes the generation of singlet molecular oxygen upon irradiation, and prolonged irradiation leads to photobleaching. TMPyP tetrachloride initially localizes preferentially in neuronal nuclei and cytoplasm, and irradiation triggers its subcellular relocalization. TMPyP tetrachloride binds to K + -free single-molecule G4-DNA nanowires via intercalation, and binds to K + -type variants via non-intercalation. TMPyP tetrachloride can be used in studies related to cancer, HIV infection and bacterial infection .
    TMPyP tetrachloride
  • HY-D1070
    DBCO-PEG4-TAMRA

    		DNA Stain Others
    DBCO-PEG4-TAMRA is a PEG-based TAMRA dye and contains a DBCO group, which enables Click Chemistry. The TAMRA dye is a dye widely used in oligonucleotide labeling and automated DNA sequencing applications. DBCO-PEG4-TAMRA is a click chemistry reagent, it contains a DBCO group that can undergo strain-promoted alkyne-azide cycloaddition (SPAAC) with molecules containing Azide groups.
    DBCO-PEG4-TAMRA
  • HY-145726
    ISIS 104838

    		TNF Receptor Cardiovascular Disease Inflammation/Immunology
    ISIS 104838 is an antisense oligonucleotide targeting TNF-α. ISIS 104838 specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 can be used for the study of inflammatory diseases .
    ISIS 104838
  • HY-D2353
    Biotin-PEG3-benzophenone

    		DNA/RNA Synthesis Cancer
    Biotin-PEG3-benzophenone is biotin-labeled Benzophenone (HY-Y0546). Benzophenone is an endogenous metabolite and a photosensitizer that has been implicated in photosensitive damage to DNA. Benzophenone causes nucleobase oxidation, formation of cyclobutane-pyrimidine dimers, single-strand breaks, DNA-protein cross-links or abasic sites, different pathologies that may occur in nucleosides, oligonucleotides or DNA .
    Biotin-PEG3-benzophenone
  • HY-157549A
    Brivoligide sodium

    AYX1 sodium

    		 Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide sodium
  • HY-D0818
    CY3-YNE

    Sulfo-Cyanine3-alkyne

    		 Fluorescent Dye Others
    CY3-YNE (Sulfo-Cyanine3-alkyne) is a dye for the labeling of soluble proteins, peptides, and oligonucleotides/DNA. CY3-YNE is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    CY3-YNE
  • HY-W570886
    2'-O-MOE-U

    		DNA/RNA Synthesis Cancer
    2'-O-MOE-U is a nucleic acid modification group (Phosphoramidite) with 3'-exonuclease inhibitory activity. 2'-O-MOE-U also exhibits gene silencing activity and double-stranded oligonucleotide stability. By forming steric interactions with 3'-exonuclease residues, 2'-O-MOE-U anchors the 3'-end of the siRNA guide strand in the hAgo2 PAZ domain, thereby regulating double-stranded thermal stability and enhancing base-pairing specificity. 2'-O-MOE-U does not induce IFNα production, can be incorporated at multiple sites of siRNA to enhance RNAi activity, and produces a synergistic effect with 2'-F modification. 2'-O-MOE-U has been widely used in studies related to breast cancer and other diseases .
    2'-O-MOE-U
  • HY-D1086
    6-Carboxy-X-rhodamine, succinimidyl ester

    6-ROX, SE

    		 DNA Stain Others
    6-Carboxy-X-rhodamine, succinimidyl ester (6-ROX, SE) is a fluorescent dye for oligonucleotide labeling and automated DNA sequencing .
    6-Carboxy-X-rhodamine, succinimidyl ester
  • HY-W048492
    7-Iodo-7-deaza-2'-deoxyguanosine

    7-Deaza-7-Iodo-2'-deoxyguanosine

    		 DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Others
    7-Iodo-7-deaza-2'-deoxyguanosine (7-Deaza-7-Iodo-2'-deoxyguanosine) is a modified deoxyguanosine nucleoside. 7-Iodo-7-deaza-2'-deoxyguanosine is used in DNA synthesis and sequencing reactions .
    7-Iodo-7-deaza-2'-deoxyguanosine
  • HY-160226
    ISD Control sodium

    		STING Inflammation/Immunology
    ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.
    ISD Control sodium
  • HY-D2267
    JF646-Hoechst

    		Fluorescent Dye Others
    JF646-Hoechst is a fluorescent red DNA probe that is an ideal substitute for large oligonucleotide-coupled antibodies used in PAINT experiments, especially for bacterial studies. JF646-Hoechst excitation/emission maximum =655/670 nm .
    JF646-Hoechst
  • HY-148947
    Cy5 Phosphoramidite

    		Fluorescent Dye Phosphoramidites Others
    Cy5 Phosphoramidite is a fluorescent labeling reagent . Cy5 Phosphoramidite serves as a fluorescent tag for 3' terminal labeling of single-stranded DNA, enabling fluorescence-based nucleic acid detection, monitoring, quantification, and in vitro study .
    Cy5 Phosphoramidite
  • HY-164732
    Fmoc-Lys(DOTA)-OH

    		Amino Acid Derivatives Biochemical Assay Reagents Others
    Fmoc-Lys (DOTA)-OH is an Fmoc-protected Lysine derivative with metal-chelating properties, containing the macrocyclic chelator DOTA. Fmoc-Lys (DOTA)-OH undergoes metallation with Tb or Lu. Fmoc-Lys (DOTA)-OH utilizes metal coordination to protect the carboxyl groups of DOTA. Fmoc-Lys (DOTA)-OH can be used in solid-phase peptide synthesis research .
    Fmoc-Lys(DOTA)-OH
  • HY-145726A
    ISIS 104838 sodium

    		TNF Receptor Cardiovascular Disease Inflammation/Immunology
    ISIS 104838 sodium is an antisense oligonucleotide targeting TNF-α. ISIS 104838 sodium specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 sodium induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 sodium can be used for the study of inflammatory diseases .
    ISIS 104838 sodium
  • HY-153479
    Aganirsen

    		Insulin Receptor Inflammation/Immunology
    Aganirsen is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).
    Aganirsen
  • HY-157549
    Brivoligide

    AYX1

    		 Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide can reduce acute post-surgical pain. Brivoligide mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide
  • HY-P2878A
    Phosphodiesterase l, Rattlesnake venom

    PDE, Rattlesnake venom

    		 Phosphodiesterase (PDE) Metabolic Disease
    Phosphodiesterase l, Rattlesnake venom (PDE, Rattlesnake venom) is a non-selective phosphodiester bond hydrolase targeting phosphodiester bonds in oligonucleotides, catalyzing their hydrolysis into mononucleotides. Phosphodiesterase l, Rattlesnake venom cleaves phosphodiester linkages in DNA fragments digested by DNase I. Phosphodiesterase l, Rattlesnake venom is promising for research of nucleic acid structure and metabolism .
    Phosphodiesterase l, Rattlesnake venom
  • HY-159162A
    7-(2-Aminoethyl)camptothecin TFA

    7CPT TFA

    		 Drug Derivative Others
    7-(2-Aminoethyl)camptothecin TFA (7CPT TFA) is the TFA salt form of Camptothecin (HY-16560) derivative 7-(2-Aminoethyl)camptothecin (HY-159162). 7-(2-Aminoethyl)camptothecin TFA can be used for synthesis of conjugate with triple helix-forming oligonucleotides (TFOs) and camptothecin (CPT). The TFO-CPT conjugate is used for DNA cleavage .
    7-(2-Aminoethyl)camptothecin TFA
  • HY-148411
    Abetimus

    LJP 394 free base

    		 DNA/RNA Synthesis Inflammation/Immunology
    Abetimus (LJP 394 free base) is an immunosuppressant consisting of four double-stranded DNA (dsDNA) oligonucleotides. Abetimus is capable of crosslinking anti-dsDNA antibodies on the surface of B cells, and decreases anti-dsDNA antibodies levels. Abetimus has the potential for research of systemic lupus erythematosus .
    Abetimus
  • HY-151686
    Bz-(Me)Tz-NHS

    		Biochemical Assay Reagents Others
    Bz-(Me)Tz-NHS is a methyltetrazine carboxylic acid NHS ester that enables conjugation of the tetrazine moiety to the 5' end of oligonucleotides via amide coupling reaction, and it is used in oligonucleotide template-mediated fluorescent bioorthogonal cycloaddition reactions. Bz-(Me) Tz-NHS is applicable to click chemistry-related studies .
    Bz-(Me)Tz-NHS
  • HY-160040
    Cobitolimod

    		Toll-like Receptor (TLR) Inflammation/Immunology
    Cobitolimod is a DNA oligonucleotide agonist of TLR-9 with anti-inflammatory activity. Cobitolimod suppresses Th17 cells and induces anti-inflammatory FoxP3 and IL-10 expression, inhibiting the IL-17 signaling pathway .
    Cobitolimod
  • HY-137721
    Cyclic tri-AMP

    		Endonuclease Infection
    Cyclic tri-AMP is a component of the cyclic oligonucleotide-based anti-phage signaling system (CBASS), and acts as the second messenger in the immune response against viral infection. Cyclic tri-AMP binds to and activates DNA endonuclease NucC, results in cell death and exhibits antiviral activity .
    Cyclic tri-AMP
  • HY-W1119950
    3'-NH-Tr-2',3'-DMF-ddA- 5'-CE-Phosphoramidite

    		Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    3'-NH-Tr-2',3'-DMF-ddA-5'-CE-Phosphoramidite is an adenine nucleotide monomer precursor used in solid-phase synthesis of oligonucleotides, particularly modified oligonucleotides, such as those with DNA chain end modifications. 3'-NH-Tr-2',3'-DMF-ddA-5'-CE-Phosphoramidite, with trityl (Tr), cyanoethyl (CE), and dimethylformamidine (DMF) protecting groups, is a ddNTP adenosine nucleoside useful in applications such as solid-phase oligonucleotide synthesis, probe design, and chain-termination sequencing .
    3'-NH-Tr-2',3'-DMF-ddA- 5'-CE-Phosphoramidite
  • HY-112858
    dSPACER

    		Biochemical Assay Reagents Phosphoramidites Others
    dSPACER is a compound for the phosphoramidite synthesis of oligonucleotides and the creation of the abasic step in the oligonucleotide sequence.Abasic phosphoramidites are used in DNA and oligonucleotide synthesis.
    dSPACER
  • HY-153479A
    Aganirsen sodium

    		Insulin Receptor Inflammation/Immunology
    Aganirsen sodium is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).
    Aganirsen sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: