Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
98 Results for "
DNA oligonucleotides
" in MedChemExpress (MCE) Product Catalog:
Products (98)
98 Results for "DNA oligonucleotides" in MCE Product Catalog:
19
19 Publications Verification
Synonyms: 1,2-Dioleoyl-3-trimethylammonium-propane chloride
5
Research Areas:
ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
5
5
Target:
Research Areas:
ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
4
4 Cited Publications
Cat. No.: HY-160225
Target:
Research Areas:
ISD sodium is an interferon-stimulatory DNA, a 45 bp non-CpG double-stranded oligonucleotide derived from the genome of Listeria monocytogenes. ISD sodium potently induces type I interferon production via the cGAS‑STING‑TBK1‑IRF3 pathway .
3
3 Cited Publications
Cat. No.: HY-D0723
CAS No.: 246256-50-8
Synonyms: 5(6)-Carboxytetramethylrhodamine N-succinimidyl ester
1
1 Cited Publications
Cat. No.: HY-D0150
CAS No.: 107091-89-4
1
1 Cited Publications
Cat. No.: HY-W039442
CAS No.: 64183-27-3
Target:
2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
1
1 Cited Publications
Cat. No.: HY-D1668
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-158712
Purity: ≥98.0%
Target:
Research Areas:
5-(Hydroxymethyl)cytidine is a purine nucleoside analog that can be used in oligonucleotide synthesis. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Research Areas:
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
Cat. No.: HY-15939
CAS No.: 92557-81-8
Cat. No.: HY-W008849
CAS No.: 102212-98-6
Cat. No.: HY-D1090
CAS No.: 82855-40-1
Target:
Research Areas:
NSC15520 is a small molecular inhibitor of Replication Protein A (RPA). NSC15520 specifically recognizes the RPA N-terminal DNA binding domain (DBD), and blocks the interaction of RPA with p53 or RAD9. NSC15520 also inhibtis helix destabilization of a duplex DNA (dsDNA) oligonucleotide, involves in DNA replication, DNA repair, DNA recombination, and DNA damage response signaling .
Cat. No.: HY-46317
CAS No.: 105931-57-5
Target:
Research Areas:
DMT-5Me-dC(Bz)-CE Phosphoramidite is a chemical structural unit that can be used in solid-phase DNA synthesis. DMT-5Me-dC(Bz)-CE Phosphoramidite can introduce the 5-methylcytidine base into the DNA chain to enhance its stability and binding affinity. DMT-5Me-dC(Bz)-CE Phosphoramidite can be used to construct modified oligonucleotides, especially for constructing locked nucleic acids (LNA) .
Cat. No.: HY-112754AGL
CAS No.: 132172-61-3
Synonyms: 1,2-Dioleoyl-3-trimethylammonium-propane chloride (GMP Like)
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
