hsa-miR-154-5p agomir

Cat. No.: HY-R00314A: Fiche technique Instruction de manipulation
FAQs
Technical Support

hsa-miR-154-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.

RNA, (UAGGUUAUCCGUGUUGCCUUCG), complex with RNA, (AAGGCAACACGGAUAACCUANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-154-5p agomir Chemical Structure

Size	Prix	Stock	Quantité
5 nmol		Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Veuillez sélectionner la quantité avant d'ajouter des articles.

This product is a controlled substance and not for sale in your territory.

Avis client

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-154-5p agomir:

hsa-miR-154-5p mimic Obtenir un devis

Recommandations en vedette

•Related Small Molecules:

•Related Proteins:

Activité biologique
Pureté et documentation
Avis client

Description	hsa-miR-154-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Masse moléculaire	15142.42
miRBase Accession Number	MI0000480
Mature miRNA Sequence	UAGGUUAUCCGUGUUGCCUUCG
Stem-loop ID	hsa-mir-154
Stem-loop Sequence	GUGGUACUUGAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUUUGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAA
Species	Human, Mouse, Rat, Cricetulus griseus, Dasypus novemcinctus, Gorilla gorilla, Guinea pig, Horse, Macaca nemestrina, Pan paniscus, Pan troglodytes, Pongo pygmaeus, Rabbit, Rhesus monkey
Livraison	Room temperature in continental US; may vary elsewhere.
Stockage	Please store the product under the recommended conditions in the Certificate of Analysis.
Pureté et documentation	Fiche technique (229 KB) Instruction de manipulation (2659 KB)