hsa-miR-16-5p agomir
Based on 1 publication(s) in Google Scholar
hsa-miR-16-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:15127.40
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Publications Citing Use of MedChemExpress (MCE) hsa-miR-16-5p agomir
More
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 15127.40
-
Color White to off-white
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
UAGCAGCACGUAAAUAUUGGCG
-
Stem-loop ID
hsa-mir-16-1
-
Stem-loop Sequence
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC
-
Species
Human, Mouse, Rat, Ateles geoffroyi, Callithrix jacchus, Chrysemys picta, Cricetulus griseus, Daubentonia madagascariensis, Dog, Gorilla gorilla, Horse, Lagothrix lagotricha, Macaca nemestrina, Metriaclima zebra, Monodelphis domestica, Nomascus leucogenys, Oreochromis niloticus, Ornithorhynchus anatinus, Otolemur garnettii, Pan paniscus, Pan troglodytes, Papio hamadryas, Pig, Pteropus alecto, Rhesus monkey, Saguinus labiatus, Saimiri boliviensis, Salmo salar
Publications (1)
-
Journal Impact Factor
-
Most Recent
Purity & Documentation
-
Data Sheet (229 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)