hsa-miR-27a-3p agomir
hsa-miR-27a-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:14493.00
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Biological Activity
Chemical Information
-
Molecular Weight 14493.00
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
UUCACAGUGGCUAAGUUCCGC
-
Stem-loop ID
hsa-mir-27a
-
Stem-loop Sequence
CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAG
-
Species
Human, Mouse, Rat, Alligator mississippiensis, Anolis carolinensis, Astatotilapia burtoni, Callithrix jacchus, Chrysemys picta, Cricetulus griseus, Cyprinus carpio, Dasypus novemcinctus, Horse, Metriaclima zebra, Monodelphis domestica, Neolamprologus brichardi, Oreochromis niloticus, Ornithorhynchus anatinus, Pig, Pundamilia nyererei, Python bivittatus, Saimiri boliviensis, Sheep, Xenopus tropicalis
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)