1. Epigenetics
  2. MicroRNA
  3. mmu-miR-670-5p agomir

mmu-miR-670-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.

RNA, (AUCCCUGAGUGUAUGUGGUGAA), complex with RNA, (CACCACAUACACUCAGGGAUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

mmu-miR-670-5p agomir Chemical Structure

Size Prix Stock Quantité
5 nmol Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* Veuillez sélectionner la quantité avant d'ajouter des articles.

This product is a controlled substance and not for sale in your territory.

Avis client

Based on 1 Customer Validation

Other Forms of mmu-miR-670-5p agomir:

Top Publications Citing Use of Products
  • Activité biologique

  • Pureté et documentation

  • Avis client

Description

mmu-miR-670-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Masse moléculaire

15165.45

miRBase Accession Number
Mature miRNA Sequence

AUCCCUGAGUGUAUGUGGUGAA

Stem-loop ID

mmu-mir-670

Stem-loop Sequence

GGUUUGGAGGUGGGCCUGACAUCCCUGAGUGUAUGUGGUGAACCUGAACUUGCCCUGGGUUUCCUCAUAUCCAUUCAGGAGUGUCAGCUGCCUCUUCGCU

Species

Mouse

Livraison

Room temperature in continental US; may vary elsewhere.

Stockage

Please store the product under the recommended conditions in the Certificate of Analysis.

Pureté et documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Calculateur de molarité

  • Calculateur de dilution

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Vos produits récemment consultés:

Demande en ligne

Your information is safe with us. * Required Fields.

Nom du produit

 

Requested Quantity *

Nom du demandeur *

 

Civilité

Adresse e-mail *

 

Numéro de téléphone *

Department

 

Nom de l'organisation *

City

État

Country or Region *

     

Remarques

Bulk Inquiry

Inquiry Information

Nom du produit:
mmu-miR-670-5p agomir
Cat. No.:
HY-R03483A
Quantité:
MCE Japan Authorized Agent: