mmu-miR-694 antagomir

Cat. No.: HY-RI03604A: Data Sheet Handling Instructions
FAQs
Technical Support

mmu-miR-694 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.

RNA, (CUUCAGGCAACAUUUUC) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

mmu-miR-694 antagomir 화학구조

사이즈	가격	재고	수량
5 nmol		견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or 대량구매 문의

* 장바구니에 담기 전 물품의 수량을 선택해 주십시오.

This product is a controlled substance and not for sale in your territory.

고객리뷰

Based on 1 publication(s) in Google Scholar

Other Forms of mmu-miR-694 antagomir:

mmu-miR-694 inhibitor 견적 받기

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
순도&문서
고객리뷰

제품 설명	mmu-miR-694 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
분자량	6266.03
miRBase Accession Number	MI0004664
Mature miRNA Sequence	CUGAAAAUGUUGCCUGAAG
Stem-loop ID	mmu-mir-694
Stem-loop Sequence	AAAGGCCAGCUCAGGCAUCGCUUUCAACCCAAGACCAGGCUGAAAAUGUUGCCUGAAGCAGUCUCUGCCU
Species	Mouse
선적	Room temperature in continental US; may vary elsewhere.
보관	Please store the product under the recommended conditions in the Certificate of Analysis.
순도&문서	Data Sheet (229 KB) Handling Instructions (2659 KB)