mmu-miR-7236-3p agomir

Cat. No.: HY-R04009A: Data Sheet Handling Instructions
FAQs
Technical Support

mmu-miR-7236-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.

RNA, (UUGGACCGCACAGAUUUAGACC), complex with RNA, (UCUAAAUCUGUGCGGUCCAANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

mmu-miR-7236-3p agomir 화학구조

사이즈	가격	재고	수량
5 nmol		견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or 대량구매 문의

* 장바구니에 담기 전 물품의 수량을 선택해 주십시오.

This product is a controlled substance and not for sale in your territory.

고객리뷰

Based on 1 publication(s) in Google Scholar

Other Forms of mmu-miR-7236-3p agomir:

mmu-miR-7236-3p mimic 견적 받기

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
순도&문서
고객리뷰

제품 설명	mmu-miR-7236-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
분자량	15102.39
miRBase Accession Number	MI0023731
Mature miRNA Sequence	UUGGACCGCACAGAUUUAGACC
Stem-loop ID	mmu-mir-7236
Stem-loop Sequence	CCUAAAACUGUGUGGUCCAAUGCCAUUUAACUACCAGGUUGGACCGCACAGAUUUAGACC
Species	Mouse
선적	Room temperature in continental US; may vary elsewhere.
보관	Please store the product under the recommended conditions in the Certificate of Analysis.
순도&문서	Data Sheet (229 KB) Handling Instructions (2659 KB)