1. Epigenetics
  2. MicroRNA
  3. rno-miR-295-3p agomir

rno-miR-295-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.

RNA, (AAGUGCUACUACUUUUGGGUGU), complex with RNA, (ACCCAAAAGUAGUAGCACUUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

rno-miR-295-3p agomir Chemische Struktur

Größe Preis Verfügbarkeit Menge
5 nmol Angebot einholen 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol Angebot einholen 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* Bitte wählen Sie Menge, bevor Sie Artikel hinzufügen.

This product is a controlled substance and not for sale in your territory.

Kundenbewertung

Based on 1 Customer Validation

Other Forms of rno-miR-295-3p agomir:

Top Publications Citing Use of Products
  • Biologische Aktivität

  • Reinheit & Dokumentation

  • Kundenbewertung

Beschreibung

rno-miR-295-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Molekulargewicht

15128.39

miRBase Accession Number
Mature miRNA Sequence

AAGUGCUACUACUUUUGGGUGU

Stem-loop ID

rno-mir-295-1

Stem-loop Sequence

CAUUUUGGUGAGACUCAAAUGUGGGGCACACUUCUGGAUUAUGCGUAGAAAGUGCUACUACUUUUGGGUGUCUCCUGUGGG

Species

Rat

Versand

Room temperature in continental US; may vary elsewhere.

Speicherung

Please store the product under the recommended conditions in the Certificate of Analysis.

Reinheit & Dokumentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Molaritätsrechner

  • Verdünnungsrechner

Die Formel zur Berechnung von Molaritäten

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Konzentration (Stammlösung) × Volumen (Stammlösung) = Konzentration (Ziellösung) × Volumen (Ziellösung)

Diese Gleichung wird häufig abgekürzt als: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Ihre kürzlich angesehenen Produkte:

Online-Anfrage

Your information is safe with us. * Required Fields.

Produktname

 

Requested Quantity *

Name des Antragstellers *

 

Anrede

E-Mail-Addresse *

 

Telefonnummer *

Department

 

Name der Organisation *

City

Bundesland

Country or Region *

     

Bemerkungen

Massenanfrage

Inquiry Information

Produktname:
rno-miR-295-3p agomir
Art. -Nr.:
HY-R04325A
Menge:
MCE Japan Authorized Agent: