1. Search Result
Search Result
Results for "

chronic

" in MedChemExpress (MCE) Product Catalog:

1635

Inhibitors & Agonists

25

Screening Libraries

14

Fluorescent Dyes

16

Biochemical Assay Reagents

79

Peptides

1

MCE Kits

78

Inhibitory Antibodies

174

Natural
Products

4

Recombinant Proteins

129

Isotope-Labeled Compounds

2

Antibodies

5

Click Chemistry

30

Oligonucleotides

1

GMP Molecules

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-B0801
    Fexofenadine
    5 Publications Verification

    MDL-16455; Terfenadine carboxylate

    Histamine Receptor Inflammation/Immunology Cancer
    Fexofenadine (MDL-16455) is an orally active and nonsedative H1 receptor antagonist. Fexofenadine can be used in allergic rhinitis and chronic idiopathic urticarial research .
    Fexofenadine
  • HY-B0801A
    Fexofenadine hydrochloride
    5 Publications Verification

    MDL-16455 hydrochloride; Terfenadine carboxylate hydrochloride

    Histamine Receptor Inflammation/Immunology Cancer
    Fexofenadine (MDL-16455) hydrochloride is an orally active and nonsedative H1 receptor antagonist. Fexofenadine hydrochloride can be used in allergic rhinitis and chronic idiopathic urticarial research .
    Fexofenadine hydrochloride
  • HY-101277
    Vadadustat
    5+ Cited Publications

    PG-1016548; AKB-6548

    HIF/HIF Prolyl-Hydroxylase Cardiovascular Disease
    Vadadustat (PG-1016548) is a titratable, oral hypoxia-inducible factor prolyl hydroxylase (HIF-PH) inhibitor . Vadadustat is an erythropoiesis-stimulating agent and has the potential for anemia treatment in chronic kidney disease in vivo .
    Vadadustat
  • HY-109170

    BAY 1817080

    P2X Receptor Inflammation/Immunology
    Eliapixant (BAY 1817080) is a potent and selective antagonist of P2X3 receptor, with an IC50 of 8 nM. Eliapixant can be used for the research of refractory chronic cough .
    Eliapixant
  • HY-132265
    SCO-267
    3 Publications Verification

    Free Fatty Acid Receptor Metabolic Disease
    SCO-267 is an allosteric GPR40 full agonist. SCO-267 can be used for the research of chronic diseases including diabetes .
    SCO-267
  • HY-P99550
    Tozorakimab
    1 Publications Verification

    MEDI-3506

    Interleukin Related Inflammation/Immunology
    Tozorakimab (MEDI-3506) is a human immunoglobulin G1 monoclonal antibody targeting interleukin-33. Tozorakimab reduces inflammation and epithelial dysfunction. Tozorakimab can be used to research chronic obstructive pulmonary disease .
    Tozorakimab
  • HY-17609
    Difelikefalin
    1 Publications Verification

    CR-845; FE-202845

    Opioid Receptor Neurological Disease Inflammation/Immunology
    Difelikefalin (CR-845) is a peripherally restricted and selective agonist of kappa opioid receptor (KOR). Difelikefalin produces anti-inflammatory effects and has the potential in modulating pruritus in conditions such as chronic kidney disease .
    Difelikefalin
  • HY-B0944
    Pidotimod
    2 Publications Verification

    Bacterial Inflammation/Immunology
    Pidotimod is an orally active dipeptide immunostimulant with immunomodulatory properties on the adaptive and the innate immune responses. Pidotimod increases macrophage activity and humoral immune functions. Pidotimod can be used for the research of chronic bronchitis, chronic obstructive pulmonary disease (COPD), bronchiectasis, and chronic idiopathic urticaria,et al .
    Pidotimod
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-113323
    3-Methoxy-4-hydroxyphenylglycol
    2 Publications Verification

    HMPG; MHPG; MOPEG

    Endogenous Metabolite Neurological Disease
    3-Methoxy-4-hydroxyphenylglycol (HMPG) is a metabolite of norepinephrine degradation in the brain. 3-Methoxy-4-hydroxyphenylglycol is an indicators of central nervous system noradrenergic activity. 3-Methoxy-4-hydroxyphenylglycol can be used for research of depression, chronic schizophrenia, etc .
    3-Methoxy-4-hydroxyphenylglycol
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-128901

    F 14679 fumarate

    5-HT Receptor Neurological Disease
    F13714 fumarate, a selective 5-HT1A receptor biased agonist, shows antidepressant-like properties after a single administration in the mouse model of chronic mild stress .
    F 13714 fumarate
  • HY-15545

    CCR Inflammation/Immunology
    AZD-4818 is a potent, orally active antagonist of chemokine CCR1. AZD-4818 can be used for researching chronic obstructive pulmonary disease (COPD) .
    AZD-4818
  • HY-100657

    meta-MDL-16455; meta-Terfenadine carboxylate

    Drug Metabolite Inflammation/Immunology
    meta-Fexofenadine (meta-MDL-16455) is an impurity of Fexofenadine . Fexofenadine, a H1R antagonist, is an anti-allergic agent used in seasonal allergic rhinitis and chronic idiopathic urticarial .
    meta-Fexofenadine
  • HY-111547

    HIF/HIF Prolyl-Hydroxylase Cancer
    M1001 is a weak hypoxia-inducible factor-2α (HIF-2α) agonist. M1001 can bind to the HIF-2α PAS-B domain, with a Kd of 667 nM. M1001 can be used in chronic kidney disease research .
    M1001
  • HY-169993

    HBV DNA/RNA Synthesis Drug Intermediate Infection
    ALG-000184 is an orally effective inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). ALG-000184 can inhibit the production of HBV DNA in liver cells. ALG-000184 can be used in the research of chronic hepatitis B .
    ALG-000184
  • HY-103595

    Mepirizole; DA-398

    Drug Derivative Inflammation/Immunology
    Epirizole (Mepirizole) is an orally active NSAID (nonsteroidal anti-inflammatory agent). Epirizole shows anti-inflammatory activity, and can be used in chronic rheumatoid arthritis research .
    Epirizole
  • HY-152036A

    PROTACs Bcr-Abl Cancer
    SIAIS100 TFA is a potent BCR-ABL PROTAC degrader with an DC50 value of 2.7 nM. SIAIS100 TFA can be used to research chronic myeloid leukemia (CML) .
    SIAIS100 TFA
  • HY-111144

    AZD0548; LAS100977

    Adrenergic Receptor Inflammation/Immunology
    Abediterol (LAS100977) is an inhaled long-acting β2-adrenoceptor agonist (LABA) and can be used for the research of asthma and chronic obstructive pulmonary disease (COPD) .
    Abediterol
  • HY-B0629

    Glucocorticoid Receptor Metabolic Disease Cancer
    Mometasone is an inhaled glucocorticoid. Mometasone can be used in mild asthma with a low sputum eosinophil level. Mometasone has the potential for the research of chronic hand eczema and rhinosinusitis .
    Mometasone
  • HY-B0010D
    Arformoterol tartrate
    1 Publications Verification

    (R,R)-Formoterol tartrate

    Adrenergic Receptor Inflammation/Immunology
    Arformoterol ((R,R)-Formoterol) tartrate, the (R,R)-enantiomer of Formoterol, is a long-acting β2-adrenergic receptor (β2-AR) agonist, with a Kd of 2.9 nM. Arformoterol tartrate can be used for the research of chronic obstructive pulmonary disease (COPD) .
    Arformoterol tartrate
  • HY-162334

    HSP Inflammation/Immunology Cancer
    HYOU1-IN-1 (Compound 33) is an inhibitor of hypoxia-upregulated protein 1 (HYOU1) with anti-inflammatory activity. HYOU1-IN-1 can be used in research on the regulation of fibroblast activation, chronic inflammation, and fibrotic diseases .
    HYOU1-IN-1
  • HY-120441

    GK115

    Phospholipase Prostaglandin Receptor Inflammation/Immunology
    CAY10590 (GK115) is an inhibitor of secreted phospholipase A2 (sPLA2) and can be used for the research of chronic inflammatory kidney diseases .
    CAY10590
  • HY-W416250

    Drug Metabolite Cardiovascular Disease
    p-Cresol glucuronide, a metabolite of p-cresol, is a prototype protein-bound uremic toxin. p-Cresol glucuronide is associated with chronic kidney disease (CKD) .
    p-Cresol glucuronide
  • HY-141411A

    (S)-MRI-1867

    Cannabinoid Receptor NO Synthase Metabolic Disease
    Zevaquenabant ((S)-MRI-1867) is a peripherally restricted, orally bioavailable dual cannabinoid CB1 receptor and inducible NOS antagonist. Zevaquenabant ameliorates obesity-induced chronic kidney disease (CKD) .
    Zevaquenabant
  • HY-B0010A
    Arformoterol
    1 Publications Verification

    (R,R)-Formoterol

    Adrenergic Receptor Inflammation/Immunology
    Arformoterol ((R,R)-Formoterol), the (R,R)-enantiomer of Formoterol, is a long-acting β2-adrenergic receptor (β2-AR) agonist, with a Kd of 2.9 nM. Arformoterol can be used for the research of chronic obstructive pulmonary disease (COPD) .
    Arformoterol
  • HY-117411A

    KW-136 dihydrochloride

    HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection .
    Coblopasvir dihydrochloride
  • HY-162008

    HSP Bcl-2 Family Cancer
    S1g-10 is a Hsp70/Bim inhibitor, and shows antitumor activity in chronic myeloid leukemia cells .
    S1g-10
  • HY-130391

    MMP Inflammation/Immunology
    MMP12-IN-3 (compound 32) is a potent MMP12 inhibitor with an IC50 value of 4.9 nM. MMP12-IN-3 has the potential for the research of chronic respiratory diseases such as emphysema .
    MMP12-IN-3
  • HY-121513

    2'-Deoxy-L-cytidine; L-dC

    HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment .
    Torcitabine
  • HY-N0117AR

    (Z)-Couroupitine B (Standard); (Z)-Indigo red (Standard); (Z)-Indigopurpurin (Standard)

    Reference Standards Apoptosis Cancer
    (Z)-Indirubin (Standard) is the analytical standard of (Z)-Indirubin (HY-N0117A). (Z)-Indirubin is an isomer of Indirubin (HY-N0117). Indirubin is a bisindole alkaloid with significant anticancer activity against chronic myeloid leukemia.
    (Z)-Indirubin (Standard)
  • HY-12733

    Dipeptidyl Peptidase Inflammation/Immunology
    AZD5248 is a dipeptidyl peptidase 1 (DPP1) inhibitor that can be used for the research of chronic obstructive lung disease .
    AZD5248
  • HY-123791

    Elastase Inflammation/Immunology
    AZD-9819 is a neutrophil elastase (HNE) inhibitor. AZD-9819 can be used to study chronic obstructive pulmonary disease .
    AZD-9819
  • HY-P11208C

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-WSTF TFA is the trifluoroacetate salt of mNLS-CPP-WSTF (HY-P11208). mNLS-CPP-WSTF is a nuclear localization signal (NLS)-cell-penetrating peptide based on the mouse WSTF sequence. mNLS-CPP-WSTF significantly inhibits the GABARAP-WSTF interaction, WSTF degradation and inflammatory gene expression. mNLS-CPP-WSTF effectively attenuates chronic inflammation, liver fibrosis and cartilage damage in metabolic-dysfunction-associated steatohepatitis (MASH) and osteoarthritis (OA) mice model. mNLS-CPP-WSTF is promising for research of chronic inflammatory diseases such as MASH and OA .
    mNLS-CPP-WSTF TFA
  • HY-19830

    Phosphodiesterase (PDE) Inflammation/Immunology
    AN3199 is a PDE4 inhibitor with an IC50 of 94.5 nM. AN3199 can be used for the research of inflammation-associated diseases such as asthma and chronic obstructive pulmonary disease (COPD) .
    AN3199
  • HY-103550

    mGluR Neurological Disease
    A-841720 is a potent, non-competitive and selective mGlu1 receptor antagonist with an IC50 of 10 nM for human mGlu1 receptor. A-841720 displays 34-fold selectivity over mGlu5 (IC50 of 342 nM), and no significant activity at a range of other neurotransmitter receptors, ion channels, and transporters. A-841720 has the potential for chronic pain research .
    A-841720
  • HY-152036

    PROTACs Bcr-Abl Cancer
    SIAIS100 is a potent BCR-ABL PROTAC degrader with an DC50 value of 2.7 nM. SIAIS100 can be used to research chronic myeloid leukemia (CML) .
    SIAIS100
  • HY-P11208A

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-scramble is a negative control peptide of mNLS-CPP-WSTF. mNLS-CPP-scramble is promising for research of chronic inflammatory diseases (e.g., MASH, osteoarthritis) .
    mNLS-CPP-scramble
  • HY-175437

    Molecular Glues Src Bcr-Abl Inflammation/Immunology Cancer
    MRT-7612 (Compound 4) is a cereblon-based tyrosine kinases molecular glue degrader. MRT-7612 significantly induces HCK and LYN degradation, with week efficacy on LCK. MRT-7612 can be used for cancers like chronic myeloid leukemia, autoimmune and chronic inflammatory diseases research .
    MRT-7612
  • HY-P11208B

    GABA Receptor Inflammation/Immunology
    mNLS-CPP-scramble (TFA) is the trifluoroacetate salt of mNLS-CPP-scramble (HY-P11208A). mNLS-CPP-scramble is a negative control peptide of mNLS-CPP-WSTF. mNLS-CPP-scramble is promising for research of chronic inflammatory diseases (e.g., MASH, osteoarthritis) .
    mNLS-CPP-scramble TFA
  • HY-P4051

    HBV Infection Inflammation/Immunology
    HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .
    HBV Seq1 aa:141-151
  • HY-144401
    DS-3801b
    1 Publications Verification

    Motilin Receptor Metabolic Disease
    DS-3801b is a potent and non-macrolide agonist of GPR38. DS-3801b is expected to be novel gastrointestinal prokinetic agents for the research of functional gastrointestinal disorders such as gastroparesis and chronic constipation .
    DS-3801b
  • HY-147132

    iGluR Neurological Disease
    GluR6 antagonist-1 is a benzothiophene derivative, acting as a GluR6 antagonist. GluR6 antagonist-1 can be used for researching acute and chronic neurological disorders .
    GluR6  antagonist-1
  • HY-143723

    Monoamine Oxidase Cardiovascular Disease Metabolic Disease Inflammation/Immunology
    SSAO inhibitor-3 (Compound 2) is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor with IC50s of <10 nM, and 0.1-10 μM for human SSAO and AOC1, respectively. SSAO inhibitor-3 can be used for the research of atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, etc .
    SSAO inhibitor-3
  • HY-17479BS

    Isotope-Labeled Compounds Others
    Amfenac-d5 sodium is deuterated-labeled Amfenac sodium. Amfenac Sodium is an orally active and potent anti-inflammatory compound possessing antipyretic and analgesic properties. Amfenac Sodium can be used for the research of acute and chronic inflammation .
    Amfenac-d5 sodium
  • HY-17479S

    Isotope-Labeled Compounds Others
    Amfenac-d5 is the deuterium labeled Amfenac. Amfenac is an orally active and potent anti-inflammatory compound possessing antipyretic and analgesic properties. Amfenac can be used for the research of acute and chronic inflammation .
    Amfenac-d5
  • HY-172143

    Phosphatase Neurological Disease Cancer
    ATUX-8385 is a potent PP2A activator. ATUX-8385 binds to PR65 subunit. ATUX-8385 has the potential for the research of cancers and chronic conditions such as Alzheimer’s disease and chronic obstructive pulmonary disease .
    ATUX-8385
  • HY-101581

    804CB; Bucloxonic acid; Esfar

    Drug Derivative Inflammation/Immunology
    Bucloxic acid is an anti-inflammatory pyrrazole derivative. Bucloxic acid can be used for study of chronic glomerular nephropathies.
    Bucloxic acid
  • HY-106448

    MR 889

    Ser/Thr Protease Inflammation/Immunology
    Midesteine (MR 889) is a proteinase inhibitor that can inhibit porcine pancreatic elastase, human neutrophil elastase and bovine chymotrypsin. Midesteine has the potential for chronic obstructive pulmonary disease (COPD) and chronic bronchitis research .
    Midesteine
  • HY-163607

    Apoptosis NF-κB Cancer
    SpiD3, a spirocyclic dimer, is an anticancer agent. SpiD3 markedly inhibits malignant B-cell proliferation and suppressed NF-κB activation independent of TME-associated stimuli. SpiD3 induces apoptosis and inhibits protein synthesis in chronic lymphocytic leukemia cells. SpiD3 can be used for study of chronic lymphocytic leukemia (CLL) .
    SpiD3

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: