2. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA reduction

" in MedChemExpress (MCE) Product Catalog:

28

Inhibitors & Agonists

1

Biochemical Assay Reagents

4

Natural
Products

3

Isotope-Labeled Compounds

5

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-W011500
    TCEP hydrochloride
    Maximum Cited Publications
    18 Publications Verification

    Tris(2-​carboxyethyl)​phosphine hydrochloride

    		 Drug Derivative Others
    TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .
    TCEP hydrochloride
  • HY-129241
    AGX51
    5+ Cited Publications

    		 DNA/RNA Synthesis DNA Alkylator/Crosslinker Cancer
    AGX51 is the first-in-class pan-Id (inhibitors of DNA-binding/differentiation proteins) antagonist and degrader. AGX51 inhibits Id1-E47 interaction, leading to ubiquitin-mediated degradation of Ids, cell growth arrest, and viability reduction. AGX51 can inhibit TNBC and has an IC50 of about 25 nM. AGX51 can be used in cancer research.
    AGX51
  • HY-W011142
    2'-Deoxyuridine 5'-monophosphate disodium

    dUMP disodium

    		 Endogenous Metabolite Infection Metabolic Disease
    2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .
    2'-Deoxyuridine 5'-monophosphate disodium
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-107004A
    Amotosalen hydrochloride
    1 Publications Verification

    S-59

    		 DNA/RNA Synthesis Parasite Inflammation/Immunology
    Amotosalen hydrochloride (S-59) is a light-activated, DNA-, RNA-crosslinking psoralen compound, which is used to neutralise pathogens. Light-activated Amotosalen binds and permanently crosslinks DNA, preventing replication and thus stopping proliferation of donor T cells. Amotosalen can be used for the study of blood system pathogen reduction technology and graft-versus-host disease (GVHD) .
    Amotosalen hydrochloride
  • HY-13543
    Tretazicar

    CB 1954

    		 Quinone Reductase DNA Alkylator/Crosslinker Cancer
    Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .
    Tretazicar
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-W011500S
    TCEP-d16 hydrochloride
    1 Publications Verification

    		 Isotope-Labeled Compounds Others
    TCEP-d16 (hydrochloride) is the deuterium labeled TCEP hydrochloride . TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .
    TCEP-d16 hydrochloride
  • HY-W013159
    2'-Deoxyguanosine 5'-monophosphate disodium
    1 Publications Verification

    5′-dGMP disodium

    		 Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease
    2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .
    2'-Deoxyguanosine 5'-monophosphate disodium
  • HY-177022
    ALG-001075

    		HBV Infection
    ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .
    ALG-001075
  • HY-16350
    BOLD-100
    1 Publications Verification

    NKP-1339; IT-139; KP-1339

    		 DNA/RNA Synthesis Apoptosis Cancer
    BOLD-100 (NKP-1339; IT-139) is the first-in-class ruthenium-based anticancer agent in development against solid cancer with limited side effects. BOLD-100 induces G2/M cell cycle arrest, blockage of DNA synthesis, and induction of apoptosis via the mitochondrial pathway. BOLD-100 has a high tumor targeting potential, strongly binds to serum proteins such as albumin and transferrin and activates in the reductive tumor milieu .
    BOLD-100
  • HY-W115721
    Rhodizonic acid disodium

    Sodium rhodizonate dibasic

    		 Reactive Oxygen Species (ROS) DNA/RNA Synthesis Others
    Rhodizonic acid disodium (Sodium rhodizonate dibasic) is a transition metal-dependent pro-oxidant and lead detection agent that induces reactive oxygen species generation, DNA damage, and inhibits Aconitase activity. Rhodizonic acid disodium generates superoxide anion radicals in an iron (II)-dependent manner, leading to aconitase inactivation. Rhodizonic acid disodium also triggers hydroxyl radical-mediated DNA strand breaks and 8-OHdG formation via copper ion reduction. Rhodizonic acid disodium reacts with lead to form a scarlet precipitate, with the color intensity proportional to lead content, enabling qualitative or quantitative analysis of lead. Rhodizonic acid disodium can also be used for real-time visualization of the dynamic process of lead sequestration in the plant rhizosphere and evaluation of the effects of environmental factors such as soil type on the stability of lead-sequestering structures .
    Rhodizonic acid disodium
  • HY-151799
    P62-RNF168 agonist-1

    		p62 E1/E2/E3 Enzyme Apoptosis Cancer
    P62-RNF168 agonist-1 (compound 5a) is a low cytotoxicity P62-RNF168 agonist that enhances the interaction between P62 and RNF168. P62-RNF168 agonist-1 induces a reduction in H2A ubiquitination mediated by RNF168 and impairs homologous recombination-mediated DNA repair. P62-RNF168 agonist-1 also inhibits the growth of xenograft tumors in mice in a dose-dependent manner .
    P62-RNF168 agonist-1
  • HY-158143
    AZD3470

    		Histone Methyltransferase Apoptosis Cancer
    AZD3470 is an orally active MTA-cooperative PRMT5 inhibitor, selective for MTAP-deficient tumors. AZD3470 induces cell cycle G2/M phase alterations, DNA damage, apoptosis, and symmetric dimethylarginine reduction. AZD3470 alters alternative splicing, increases skipped exon events in DNA repair and cell cycle pathways, and inhibits cancer cell proliferation and tumor growth. AZD3470 can be used for the research of non-small cell lung cancer and MTAP-deleted solid tumors .
    AZD3470
  • HY-W013159S
    2'-Deoxyguanosine 5'-monophosphate-13C10,15N5 disodium

    5′-dGMP-13C10,15N5 disodium

    		 Isotope-Labeled Compounds Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease
    2'-Deoxyguanosine 5'-monophosphate- 13C10, 15N5 (dGMP- 13C10, 15N5) disodium is the 13C and 15N labeled 2'-Deoxyguanosine 5'-monophosphate disodium (HY-W013159). 2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .
    2'-Deoxyguanosine 5'-monophosphate-13C10,15N5 disodium
  • HY-W394006
    2'-Deoxyuridine 5'-monophosphate

    dUMP

    		 Endogenous Metabolite Infection Metabolic Disease
    2'-Deoxyuridine 5'-monophosphate (dUMP) is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .
    2'-Deoxyuridine 5'-monophosphate
  • HY-144319
    SHR5133

    		HBV Infection
    SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM) .
    SHR5133
  • HY-129762
    Yoshi-864

    NSC-102627

    		 DNA/RNA Synthesis Cancer
    Yoshi-864 (NSC-102627) is an alkylsulfonate DNA crosslinker with anticancer activity. Yoshi-864 extends markedly the survival times of mice bearing L1210 leukemia or Ehrlich ascites carcinoma. Yoshi-864 also has a persistent reduction in ability to synthesize DNA in tumor cells from mice bearing the Ehrlich tumor .
    Yoshi-864
  • HY-107004
    Amotosalen

    S-59 free base

    		 DNA/RNA Synthesis Parasite Inflammation/Immunology
    Amotosalen (S-59 (free base)) is a light-activated, DNA and RNA-crosslinking psoralen compound, which is used to neutralise pathogens. Light-activated Amotosalen binds and permanently crosslinks DNA, preventing replication and thus stopping proliferation of donor T cells. Amotosalen can be used for the study of blood system pathogen reduction technology and graft-versus-host disease (GVHD) .
    Amotosalen
  • HY-U00279B
    Nitracrine hydrochloride

    		DNA/RNA Synthesis Cancer
    Nitracrine hydrochloride is a platinum-based antineoplastic drug with selective toxicity to hypoxic cells. Nitracrine hydrochloride exhibits significant cytotoxicity against the Chinese hamster ovary cell line AA8 under hypoxic conditions. Nitracrine hydrochloride exerts its effect by binding to the insertion of DNA and forming covalent adducts. The cytotoxicity of Nitracrine hydrochloride under hypoxic conditions is related to its reductive metabolism to form alkylated substances. At the same time, it may enhance the reactivity to DNA through the insertion of DNA, thereby improving the efficacy. Nitracrine hydrochloride can also inhibit RNA synthesis, contributing to its anti-tumor effect .
    Nitracrine hydrochloride
  • HY-13543R
    Tretazicar (Standard)

    CB 1954 (Standard)

    		 DNA Alkylator/Crosslinker Reference Standards Cancer
    Tretazicar (Standard) is the analytical standard of Tretazicar. This product is intended for research and analytical applications. Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .
    Tretazicar (Standard)
  • HY-W700621
    TCEP-d12 hydrochloride

    Tris(2-​carboxyethyl)​phosphine hydrochloride-d12

    		 Isotope-Labeled Compounds Others Others
    TCEP-d12 (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d12) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .
    TCEP-d12 hydrochloride
  • HY-118722
    RB-90740

    		DNA/RNA Synthesis Cytochrome P450 Cancer
    RB-90740 is a type of biological reducing agent. RB-90740 is activated through metabolic reduction and generates cytotoxic products, thereby selectively killing tumor cells (usually in a hypoxic environment). RB-90740 has selective toxicity towards hypoxic cells, which is mainly achieved by causing DNA strand breaks and activating reducing enzymes (such as Cytochrome P450). RB-90740 does not initially exhibit cytotoxicity similar to its in vitro properties in hypoxic cells in mouse models. RB-90740 can be used to study the tumor physiological environment
    RB-90740
  • HY-107004AR
    Amotosalen hydrochloride (Standard)

    S-59 (Standard)

    		 Reference Standards DNA/RNA Synthesis Parasite Inflammation/Immunology
    Amotosalen hydrochloride (Standard) (S-59 (Standard)) is the analytical standard of Amotosalen (hydrochloride) (HY-107004A). This product is intended for research and analytical applications. Amotosalen hydrochloride (S-59) is a light-activated, DNA-, RNA-crosslinKing psoralen compound, which is used to neutralise pathogens. Light-activated Amotosalen binds and permanently crosslinks DNA, preventing replication and thus stopping proliferation of donor T cells. Amotosalen can be used for the study of blood system pathogen reduction technology and graft-versus-host disease (GVHD) .
    Amotosalen hydrochloride (Standard)
  • HY-124693
    DB1055

    		Apoptosis Cancer
    DB1055 is a HOXA9 inhibitor that competes with HOXA9 binding to DNA (blocking its DNA interaction activity). DB1055 induces in vitro cell growth reduction, cell apoptosis, and differentiation in human acute myeloid leukemia (AML) cells. DB1055 leads to monocyte-to-macrophage differentiation and exhibits antileukemic activities in a human THP-1 AML in vivo model. DB1055 does not impact human CD34+ bone marrow cells. DB1055 can be used for the research of acute myeloid leukemia[1].
    DB1055
  • HY-W011142R
    2'-Deoxyuridine 5'-monophosphate disodium (Standard)

    dUMP disodium (Standard)

    		 Endogenous Metabolite Reference Standards Infection Metabolic Disease
    2'-Deoxyuridine 5'-monophosphate (disodium) (Standard) is the analytical standard of 2'-Deoxyuridine 5'-monophosphate (disodium) (HY-W011142). This product is intended for research and analytical applications. 2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .
    2'-Deoxyuridine 5'-monophosphate disodium (Standard)
  • HY-134273A
    8-Br-dGTP sodium

    8-Bromo-dGTP sodium

    		 Nucleoside Antimetabolite/Analog Others
    8-Br-dGTP (8-Bromo-dGTP) sodium (Compound 5), an 8-brominated purine nucleotide, is a syn-oriented analog of dGTP. 8-Br-dGTP sodium can be hydrolyzed by the enzyme hMTH1 protein (HY-P74740). 8-Br-dGTP sodium inhibits dGTP-activated ADP reduction with a Ki of 56  μM. 8-Br-dGTP sodium has no significant genotoxicity and mutagenic potentials during DNA synthesis .
    8-Br-dGTP sodium
  • HY-W013159R
    2'-Deoxyguanosine 5'-monophosphate disodium (Standard)

    5′-dGMP disodium (Standard)

    		 Endogenous Metabolite Reference Standards Nucleoside Antimetabolite/Analog Metabolic Disease
    2'-Deoxyguanosine 5'-monophosphate (disodium) (Standard) is the analytical standard of 2'-Deoxyguanosine 5'-monophosphate (disodium) (HY-W013159). This product is intended for research and analytical applications. 2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .
    2'-Deoxyguanosine 5'-monophosphate disodium (Standard)

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: