1 Result for "

Inactive ASO (in vivo)

" in MedChemExpress (MCE) Product Catalog:
Products (1)

1 Results for "Inactive ASO (in vivo)" in MCE Product Catalog:

Inactive ASO (in vivo) sodium
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity:  92.18%
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
loading...
    loading...