Bepirovirsen
Based on 1 Customer Validation
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.
- Reinheit: 97.10%
- CAS. Nr.: 1403787-62-1
- Molecular Weight:7344.00
-
Speicherung:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biologische Aktivität
Beschreibung
In Vitro
Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells[1].
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
In Vivo
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
-
Animal Model:Male HBV transgenic mice (Tg[HBV 1.3 genome]Chi32 against C57BL/6 background) aged 7-12 weeks and weight 18-25 g[1].
-
Dosage:22, 50 mg/kg/week
-
Administration:Injected subcutaneously twice weekly for week 1 and once weekly for weeks 2-4
-
Result:Dose-dependently reduced hepatic levels of HBV DNA and HBV RNA in HBV transgenic mice.
Reduced levels of serum HBV DNA, serum HBsAg and serum HBeAg.
Clinical Trial
| NCT Number | Sponsor | Condition | Start Date |
Phase
|
|---|---|---|---|---|
| NCT01329991 | Plexxikon| | 2011-05 | PHASE1 |
Chemical Information
-
CAS. Nr. 1403787-62-1
-
Appearance Solid
-
Molecular Weight 7344.00
-
Color White to off-white
-
SMILES
[Bepirovirsen]
-
Synonyms
ISIS 505358
-
Sequence
DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)
-
Versand
Room temperature in continental US; may vary elsewhere.
-
Speicherung
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Lösungsmittel & Löslichkeit
In Vitro:
H2O : ≥ 20 mg/mL (2.72 mM)
* "≥" means soluble, but saturation unknown.
Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.
* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.
Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.
* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.
Konzentration (Stammlösung) × Volumen (Stammlösung) = Konzentration (Ziellösung) × Volumen (Ziellösung)
Reinheit & Dokumentation
-
Data Sheet (273 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Handling Instructions (2242 KB)
Verweise
[1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734. [Content Brief]
[2]. Han K, et, al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202. [Content Brief]
Complete Stock Solution Preparation Table
Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.
| Optional Solvent | Concentration Solvent Mass | 1 mg | 5 mg | 10 mg | 25 mg |
|---|---|---|---|---|---|
| H2O | 1 mM | 0.1362 mL | 0.6808 mL | 1.3617 mL | 3.4041 mL |
* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.