Bepirovirsen

(Synonyms: ISIS 505358)
Avis client

Based on 1 Customer Validation

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.

  • Pureté: 97.10%
  • CAS No.: 1403787-62-1
  • Masse moléculaire:7344.00
  • Stockage:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Activité biologique
  • Chemical Information
  • Solvant et solubilité
  • Pureté et documentation
  • Références
  • Help & FAQs
MOQ
Minimum order quantity
100 mg

Obtenir un devis En stock

Other size
Obtenir un devis
Please select quantity
Amount: USD 0.00