Bepirovirsen

(Synonyms: ISIS 505358)
Kundenbewertung

Based on 1 Customer Validation

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.

  • Reinheit: 97.10%
  • CAS. Nr.: 1403787-62-1
  • Molecular Weight:7344.00
  • Speicherung:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Biologische Aktivität
  • Chemical Information
  • Lösungsmittel & Löslichkeit
  • Reinheit & Dokumentation
  • Verweise
  • Help & FAQs
MOQ
Minimum order quantity
100 mg

Angebot einholen Auf Lager

Other size
Angebot einholen
Please select quantity
Amount: USD 0.00