Bepirovirsen

(Synonyms: ISIS 505358)
고객리뷰

Based on 1 Customer Validation

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.

  • 보관:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Biological Activity
  • Chemical Information
  • 용액&용해도
  • 순도&문서
  • References
  • Help & FAQs
100 mg

견적 받기 해외재고보유

Please select quantity
Amount: USD 0.00