Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
53 Results for "
ASO
" in MedChemExpress (MCE) Product Catalog:
Products (53)
53 Results for "ASO" in MCE Product Catalog:
Cat. No.: HY-W190913
CAS No.: 2226472-28-0
Research Areas:
DBCO-PEG4-Val-Cit-PAB-PNP is a linker. DBCO-PEG4-Val-Cit-PAB-PNP conjugates anti-SYT2 monoclonal antibody with MALAT1 gapmer antisense oligonucleotides without inhibiting ASO activity or impairing the binding efficiency of the antibody to SYT2 antigen .
Cat. No.: HY-132581E
Synonyms: Scrambled BIIB078; Scrambled IONIS-C9Rx
Target:
Research Areas:
Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
Cat. No.: HY-159695A
Synonyms: ISIS 426115 sodium
Target:
Research Areas:
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
Synonyms: RG6091 sodium; RO7248824 sodium
Target:
Research Areas:
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Cat. No.: HY-148687
Target:
Research Areas:
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
Cat. No.: HY-177615A
Synonyms: GTX-102 sodium
Target:
Research Areas:
Apazunersen sodium is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient
Cat. No.: HY-177615
CAS No.: 2919324-01-7
Synonyms: GTX-102
Target:
Research Areas:
Apazunersen is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient protei
Cat. No.: HY-P10567
Target:
Research Areas:
Cat. No.: HY-159695
CAS No.: 1431900-72-9
Synonyms: ISIS 426115
Target:
Research Areas:
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
Cat. No.: HY-122740
CAS No.: 313683-81-7
Retro-1 is a toxin inhibitor. Retro-1 blocks the retrograde transport of STxB to the trans-Golgi network/Golgi. Retro-1 inhibits the cytotoxic effects of Ricin, bacterial toxins Stx1 and Stx2. Retro-1 can also substantially enhance the effectiveness of antisense and splice switching oligonucleotides .
Cat. No.: HY-132581C
Synonyms: Scrambled BIIB078 sodium; Scrambled IONIS-C9Rx sodium
Target:
Research Areas:
Scrambled Tadnersen sodium is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
Cat. No.: HY-158825
CAS No.: 2252375-14-5
Synonyms: CIVI007 sodium
Target:
Research Areas:
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia research and the prevention of atherosclerotic cardiovascular disease (ASCVD).
Cat. No.: HY-158827
CAS No.: 2604215-74-7
Target:
Research Areas:
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
0 Images
MDM4-targeting ASO (sodium)
Cat. No.: HY-158830
Cat. No.: HY-177616A
Synonyms: RX-0201 sodium
Archexin sodium is an antisense oligonucleotide (ASO) against Akt1. It is used for the study of metastatic renal cancer.
Cat. No.: HY-148688D
Target:
Research Areas:
FAM labled ASO 556089 sodiumis a FAM labled ASO 556089 sodium.
Cat. No.: HY-148688E
Target:
Research Areas:
Cy3 labled ASO 556089 sodium is a Cy3 labled ASO 556089 sodium.
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
