TANGO1-L Human scramble negative control
TANGO1-L Human scramble negative control is the scrambled negative control for TANGO1-L small interfering RNA.
Para uso exclusivo en investigación. No vendemos a pacientes.
-
Almacenamiento:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Actividad biológica
Descripciòn
Chemical Information
-
Appearance Solid
-
Color Colorless to off-white
-
SMILES
[CAGCATCTCTCAAGCAGTCTCTGAC]
-
Envío
Room temperature in continental US; may vary elsewhere.
-
Almacenamiento
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Pureza y Documentación
-
Ficha de datos (236 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Instrucciones de manejo (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)