hsa-miR-184 agomir
hsa-miR-184 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:15158.41
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Biological Activity
Chemical Information
-
Molecular Weight 15158.41
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
UGGACGGAGAACUGAUAAGGGU
-
Stem-loop ID
hsa-mir-184
-
Stem-loop Sequence
CCAGUCACGUCCCCUUAUCACUUUUCCAGCCCAGCUUUGUGACUGUAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA
-
Species
Human, Mouse, Rat, Alligator mississippiensis, Anolis carolinensis, Bovine, Callithrix jacchus, Chicken, Chrysemys picta, Columba livia, Cricetulus griseus, Dasypus novemcinctus, Dog, Goat, Guinea pig, Horse, Macaca nemestrina, Monodelphis domestica, Otolemur garnettii, Pan troglodytes, Pig, Pongo pygmaeus, Pteropus alecto, Rabbit, Rhesus monkey, Taeniopygia guttata, Tupaia chinensis
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)