1. Epigenetics
  2. MicroRNA
  3. hsa-miR-19a-5p antagomir

hsa-miR-19a-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.

RNA, (UGUAGUGCAACUAUGCAAAA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-19a-5p antagomir 화학구조

사이즈 가격 재고 수량
5 nmol 견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol 견적 받기 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* 장바구니에 담기 전 물품의 수량을 선택해 주십시오.

This product is a controlled substance and not for sale in your territory.

고객리뷰

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-19a-5p antagomir:

Top Publications Citing Use of Products
  • Biological Activity

  • 순도&문서

  • 고객리뷰

제품 설명

hsa-miR-19a-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

분자량

7398.83

miRBase Accession Number
Mature miRNA Sequence

AGUUUUGCAUAGUUGCACUACA

Stem-loop ID

hsa-mir-19a

Stem-loop Sequence

GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC

Species

Human, Chrysemys picta

선적

Room temperature in continental US; may vary elsewhere.

보관

Please store the product under the recommended conditions in the Certificate of Analysis.

순도&문서
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • 몰농도 계산기

  • 농도 희석 계산기

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

최근 본 상품:

온라인 문의

Your information is safe with us. * Required Fields.

상품명

 

Requested Quantity *

고객명 *

 

호칭

메일주소 *

 

전화번호 *

Department

 

회사명 *

City

Country or Region *

     

비고

대량구매 문의

Inquiry Information

상품명:
hsa-miR-19a-5p antagomir
Cat. No.:
HY-RI00402A
수량:
MCE Japan Authorized Agent: