1. Epigenetics
  2. MicroRNA
  3. hsa-miR-30b-5p agomir

hsa-miR-30b-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Para uso exclusivo en investigación. No vendemos a pacientes.

RNA, (UGUAAACAUCCUACACUCAGCU), complex with RNA, (CUGAGUGUAGGAUGUUUACANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-30b-5p agomir Estructura química

Tamaño Precio Stock Cantidad
5 nmol Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* Seleccione Cantidad antes de agregar artículos.

This product is a controlled substance and not for sale in your territory.

Revisión del cliente

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-30b-5p agomir:

Top Publications Citing Use of Products
  • Actividad biológica

  • Pureza y Documentación

  • Revisión del cliente

Descripciòn

hsa-miR-30b-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Peso molecular

15088.36

miRBase Accession Number
Mature miRNA Sequence

UGUAAACAUCCUACACUCAGCU

Stem-loop ID

hsa-mir-30b

Stem-loop Sequence

ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGA

Species

Human, Mouse, Rat, Alligator mississippiensis, Anolis carolinensis, Astatotilapia burtoni, Bovine, Callithrix jacchus, Chicken, Chrysemys picta, Cricetulus griseus, Cyprinus carpio, Dasypus novemcinctus, Dog, Fugu rubripes, Gadus morhua, Goat, Guinea pig, Horse, Ictalurus punctatus, Metriaclima zebra, Monodelphis domestica, Neolamprologus brichardi, Nomascus leucogenys, Ophiophagus hannah, Oreochromis niloticus, Ornithorhynchus anatinus, Otolemur garnettii, Pig, Pongo pygmaeus, Pteropus alecto, Pundamilia nyererei, Python bivittatus, Rabbit, Salmo salar, Taeniopygia guttata, Tetraodon nigroviridis, Tupaia chinensis, Xenopus laevis, Xenopus tropicalis, Zebrafish

Envío

Room temperature in continental US; may vary elsewhere.

Almacenamiento

Please store the product under the recommended conditions in the Certificate of Analysis.

Pureza y Documentación
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Calculadora de molaridad

  • Calculadora de dilución

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Productos vistos recientemente:

Consulta en línea

Your information is safe with us. * Required Fields.

Nombre del producto

 

Requested Quantity *

Nombre del solicitante *

 

Saludo

Direcciòn del E-mail *

 

Número de teléfono *

Department

 

Nombre de la Organizaciòn *

City

Provincia

Country or Region *

     

Observaciones

Consulta para venta a granel

Inquiry Information

Nombre del producto:
hsa-miR-30b-5p agomir
Cat. No.:
HY-R00537A
Cantidad:
MCE Japan Authorized Agent: